Incidental Mutation 'R7602:Ddx24'
ID588080
Institutional Source Beutler Lab
Gene Symbol Ddx24
Ensembl Gene ENSMUSG00000041645
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Synonyms2510027P10Rik, 1700055J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location103407982-103425830 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 103416260 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 688 (L688*)
Ref Sequence ENSEMBL: ENSMUSP00000105628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044923] [ENSMUST00000110001] [ENSMUST00000221211]
Predicted Effect probably null
Transcript: ENSMUST00000044923
AA Change: L642*
SMART Domains Protein: ENSMUSP00000040890
Gene: ENSMUSG00000041645
AA Change: L642*

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 168 180 N/A INTRINSIC
DEXDc 212 541 1.14e-39 SMART
HELICc 601 682 5.22e-25 SMART
low complexity region 752 766 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110001
AA Change: L688*
SMART Domains Protein: ENSMUSP00000105628
Gene: ENSMUSG00000041645
AA Change: L688*

DomainStartEndE-ValueType
low complexity region 140 147 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
low complexity region 214 226 N/A INTRINSIC
DEXDc 258 587 1.14e-39 SMART
HELICc 647 728 5.22e-25 SMART
low complexity region 798 812 N/A INTRINSIC
low complexity region 821 833 N/A INTRINSIC
low complexity region 881 898 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000221211
AA Change: L642*
Predicted Effect probably null
Transcript: ENSMUST00000222782
AA Change: L23*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which shows little similarity to any of the other known human DEAD box proteins, but shows a high similarity to mouse Ddx24 at the amino acid level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal: embryos die between implantation and placentation. Heterozygous KO animals are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Ddx24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Ddx24 APN 12 103418202 missense probably damaging 0.97
IGL02102:Ddx24 APN 12 103408484 intron probably benign
IGL02225:Ddx24 APN 12 103417371 missense probably damaging 1.00
IGL02226:Ddx24 APN 12 103424458 missense possibly damaging 0.81
IGL02325:Ddx24 APN 12 103416266 missense probably damaging 1.00
IGL02568:Ddx24 APN 12 103417312 missense probably damaging 1.00
IGL02666:Ddx24 APN 12 103424055 missense possibly damaging 0.94
IGL02950:Ddx24 APN 12 103417542 missense probably damaging 1.00
IGL03244:Ddx24 APN 12 103417605 missense possibly damaging 0.53
P0028:Ddx24 UTSW 12 103408375 missense probably benign
R0195:Ddx24 UTSW 12 103418961 critical splice donor site probably null
R0540:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0607:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0621:Ddx24 UTSW 12 103425558 intron probably benign
R0964:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R1447:Ddx24 UTSW 12 103424307 missense possibly damaging 0.88
R1639:Ddx24 UTSW 12 103411319 critical splice acceptor site probably null
R1909:Ddx24 UTSW 12 103409982 missense probably damaging 0.99
R2418:Ddx24 UTSW 12 103417737 missense probably damaging 1.00
R3706:Ddx24 UTSW 12 103417416 missense probably damaging 1.00
R3725:Ddx24 UTSW 12 103417605 missense probably benign 0.19
R4436:Ddx24 UTSW 12 103423974 missense probably damaging 1.00
R4807:Ddx24 UTSW 12 103419461 missense probably damaging 1.00
R5568:Ddx24 UTSW 12 103424288 missense possibly damaging 0.46
R5629:Ddx24 UTSW 12 103425547 intron probably benign
R5763:Ddx24 UTSW 12 103417414 missense probably damaging 1.00
R5891:Ddx24 UTSW 12 103424058 missense probably damaging 1.00
R6059:Ddx24 UTSW 12 103408300 missense probably damaging 1.00
R6310:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6311:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6408:Ddx24 UTSW 12 103425560 intron probably benign
R6648:Ddx24 UTSW 12 103408375 missense probably benign 0.02
R7151:Ddx24 UTSW 12 103424088 missense probably benign 0.00
R7299:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7301:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7324:Ddx24 UTSW 12 103416259 missense probably damaging 1.00
R7513:Ddx24 UTSW 12 103419106 nonsense probably null
R7734:Ddx24 UTSW 12 103417560 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CGTTACAGACAACCTGAGGG -3'
(R):5'- GCTTCAGTTCATTCACAGCAC -3'

Sequencing Primer
(F):5'- CAGACAACCTGAGGGGGCAG -3'
(R):5'- GGGTCCTGATTCCACAATAGACTAG -3'
Posted On2019-10-24