Incidental Mutation 'R7602:Zfr'
ID588085
Institutional Source Beutler Lab
Gene Symbol Zfr
Ensembl Gene ENSMUSG00000022201
Gene Namezinc finger RNA binding protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location12117831-12185683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12159677 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 686 (D686E)
Ref Sequence ENSEMBL: ENSMUSP00000118911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000122941
AA Change: D686E

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: D686E

DomainStartEndE-ValueType
low complexity region 69 116 N/A INTRINSIC
low complexity region 159 182 N/A INTRINSIC
low complexity region 196 224 N/A INTRINSIC
low complexity region 229 302 N/A INTRINSIC
ZnF_U1 328 362 7.79e-6 SMART
ZnF_C2H2 331 355 4.94e0 SMART
ZnF_U1 379 413 1.84e-7 SMART
ZnF_C2H2 382 406 4.65e-1 SMART
low complexity region 429 448 N/A INTRINSIC
low complexity region 468 483 N/A INTRINSIC
ZnF_U1 579 613 2.01e-8 SMART
ZnF_C2H2 582 606 1.31e0 SMART
low complexity region 630 664 N/A INTRINSIC
low complexity region 685 719 N/A INTRINSIC
low complexity region 766 782 N/A INTRINSIC
DZF 784 1038 5.42e-170 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114992
Gene: ENSMUSG00000022201
AA Change: D19E

DomainStartEndE-ValueType
low complexity region 19 53 N/A INTRINSIC
PDB:4ATB|D 56 94 6e-11 PDB
low complexity region 100 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156752
SMART Domains Protein: ENSMUSP00000119251
Gene: ENSMUSG00000022201

DomainStartEndE-ValueType
low complexity region 34 52 N/A INTRINSIC
DZF 57 299 1.79e-152 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Zfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Zfr APN 15 12159646 missense probably benign 0.26
IGL01759:Zfr APN 15 12159655 missense probably damaging 0.99
IGL01935:Zfr APN 15 12180712 missense probably benign 0.42
IGL02056:Zfr APN 15 12154447 missense probably damaging 1.00
IGL03009:Zfr APN 15 12162235 missense probably damaging 1.00
IGL03147:Zfr UTSW 15 12140552 nonsense probably null
PIT4504001:Zfr UTSW 15 12166158 missense possibly damaging 0.48
R0377:Zfr UTSW 15 12160591 missense probably benign 0.02
R0678:Zfr UTSW 15 12184085 missense probably damaging 1.00
R0783:Zfr UTSW 15 12162182 missense probably damaging 1.00
R0787:Zfr UTSW 15 12140548 missense unknown
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1538:Zfr UTSW 15 12150243 missense possibly damaging 0.61
R1558:Zfr UTSW 15 12140644 missense unknown
R1619:Zfr UTSW 15 12150387 missense possibly damaging 0.52
R1924:Zfr UTSW 15 12160629 missense possibly damaging 0.74
R2163:Zfr UTSW 15 12162223 missense probably damaging 1.00
R2958:Zfr UTSW 15 12162233 missense probably benign 0.08
R2960:Zfr UTSW 15 12162233 missense probably benign 0.08
R2961:Zfr UTSW 15 12162233 missense probably benign 0.08
R2962:Zfr UTSW 15 12162233 missense probably benign 0.08
R2963:Zfr UTSW 15 12162233 missense probably benign 0.08
R3012:Zfr UTSW 15 12166163 missense probably damaging 1.00
R3054:Zfr UTSW 15 12154507 missense probably damaging 1.00
R3429:Zfr UTSW 15 12152920 missense probably benign 0.00
R3611:Zfr UTSW 15 12159762 critical splice donor site probably null
R3825:Zfr UTSW 15 12166191 missense probably damaging 1.00
R3882:Zfr UTSW 15 12162233 missense probably benign 0.08
R4080:Zfr UTSW 15 12162233 missense probably benign 0.08
R4241:Zfr UTSW 15 12149659 missense probably damaging 1.00
R4366:Zfr UTSW 15 12156330 missense probably damaging 0.99
R4375:Zfr UTSW 15 12118340 critical splice donor site probably null
R4893:Zfr UTSW 15 12136542 missense unknown
R4899:Zfr UTSW 15 12166145 missense probably benign 0.11
R4915:Zfr UTSW 15 12162112 critical splice acceptor site probably null
R5870:Zfr UTSW 15 12160615 missense probably damaging 1.00
R6162:Zfr UTSW 15 12146245 missense unknown
R6163:Zfr UTSW 15 12146245 missense unknown
R6165:Zfr UTSW 15 12146245 missense unknown
R6187:Zfr UTSW 15 12146231 small deletion probably benign
R6251:Zfr UTSW 15 12160591 missense probably benign 0.02
R6903:Zfr UTSW 15 12136455 missense unknown
R6959:Zfr UTSW 15 12150323 missense probably damaging 1.00
R7133:Zfr UTSW 15 12180638 missense probably damaging 1.00
R7167:Zfr UTSW 15 12180929 missense probably benign 0.01
R7212:Zfr UTSW 15 12146223 nonsense probably null
R7373:Zfr UTSW 15 12140559 missense unknown
R7489:Zfr UTSW 15 12152982 missense probably benign 0.24
R7623:Zfr UTSW 15 12160528 missense possibly damaging 0.83
R7896:Zfr UTSW 15 12146377 missense probably damaging 1.00
R7979:Zfr UTSW 15 12146377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATAAACTGAGGTGTCTGTTTTCTG -3'
(R):5'- AGGAAACTTGACTAAGTCCTTATGT -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- CACCCCTTAGATAAGCAGA -3'
Posted On2019-10-24