Incidental Mutation 'R7602:Olfr173'
ID588088
Institutional Source Beutler Lab
Gene Symbol Olfr173
Ensembl Gene ENSMUSG00000049362
Gene Nameolfactory receptor 173
SynonymsMOR184-3, GA_x54KRFPKG5P-54960233-54959268
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58795207-58800268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58796980 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 289 (I289V)
Ref Sequence ENSEMBL: ENSMUSP00000145946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049940] [ENSMUST00000206205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049940
AA Change: I289V

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052798
Gene: ENSMUSG00000049362
AA Change: I289V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-52 PFAM
Pfam:7tm_1 41 290 9.7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206205
AA Change: I289V

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dhx57 G T 17: 80,274,861 N438K probably benign Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Olfr173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02649:Olfr173 APN 16 58797350 missense probably damaging 1.00
IGL02728:Olfr173 APN 16 58797480 missense probably benign 0.07
IGL02893:Olfr173 APN 16 58797657 missense probably damaging 1.00
R0035:Olfr173 UTSW 16 58797122 nonsense probably null
R0480:Olfr173 UTSW 16 58797321 missense probably benign 0.05
R1101:Olfr173 UTSW 16 58797252 missense probably benign 0.27
R1434:Olfr173 UTSW 16 58797448 missense probably benign 0.06
R1992:Olfr173 UTSW 16 58796946 missense probably benign
R2220:Olfr173 UTSW 16 58797624 missense possibly damaging 0.69
R2436:Olfr173 UTSW 16 58797244 missense probably benign 0.00
R4212:Olfr173 UTSW 16 58797369 missense possibly damaging 0.67
R4910:Olfr173 UTSW 16 58797442 missense probably benign 0.03
R5666:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5670:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5896:Olfr173 UTSW 16 58797732 missense probably damaging 1.00
R6182:Olfr173 UTSW 16 58797292 missense probably damaging 1.00
R6613:Olfr173 UTSW 16 58797531 missense probably damaging 0.99
R6723:Olfr173 UTSW 16 58797432 missense probably benign 0.06
R7051:Olfr173 UTSW 16 58797175 missense probably benign 0.21
R7141:Olfr173 UTSW 16 58797408 missense probably benign 0.05
R7179:Olfr173 UTSW 16 58796887 missense probably benign 0.00
Z1176:Olfr173 UTSW 16 58797423 missense probably damaging 1.00
Z1176:Olfr173 UTSW 16 58797673 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTCTTAAGAAAGCCTTATGGAC -3'
(R):5'- AGGCTCAATCCAAGTCTTCAC -3'

Sequencing Primer
(F):5'- GGACTTTAACATTTTTGCACACAG -3'
(R):5'- GGCTCAATCCAAGTCTTCACAATAGG -3'
Posted On2019-10-24