Incidental Mutation 'R7602:Dhx57'
ID 588091
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 045674-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R7602 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80582290 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 438 (N438K)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably benign
Transcript: ENSMUST00000038166
AA Change: N385K

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: N385K

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086555
AA Change: N438K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: N438K

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik A T 1: 151,856,266 (GRCm39) Y34N probably damaging Het
A2m T C 6: 121,618,966 (GRCm39) V237A probably damaging Het
A2m A T 6: 121,647,895 (GRCm39) D1129V possibly damaging Het
Aadacl2fm3 T C 3: 59,784,697 (GRCm39) I390T probably benign Het
Abca7 A G 10: 79,833,846 (GRCm39) probably null Het
Adam34l C T 8: 44,079,703 (GRCm39) G174R probably damaging Het
Ap3m2 T C 8: 23,282,770 (GRCm39) N256S probably benign Het
Atr C T 9: 95,789,436 (GRCm39) H1531Y possibly damaging Het
Carmil3 C T 14: 55,738,965 (GRCm39) A873V probably null Het
Casp8 A C 1: 58,872,898 (GRCm39) K258T probably benign Het
Cast A G 13: 74,885,084 (GRCm39) S222P probably benign Het
Cpsf7 C T 19: 10,512,737 (GRCm39) P274S probably damaging Het
Ddx24 A T 12: 103,382,519 (GRCm39) L688* probably null Het
Ddx59 A G 1: 136,361,559 (GRCm39) I475V probably benign Het
Dhx29 T A 13: 113,081,093 (GRCm39) S376T possibly damaging Het
Dlk1 T A 12: 109,421,551 (GRCm39) probably null Het
Efcab15 T C 11: 103,091,004 (GRCm39) M114V probably benign Het
Epha6 T C 16: 59,595,931 (GRCm39) D920G probably damaging Het
Exo5 A T 4: 120,778,818 (GRCm39) V349E probably benign Het
Fam234b T C 6: 135,202,241 (GRCm39) V321A possibly damaging Het
Gbp3 A G 3: 142,274,822 (GRCm39) E383G probably benign Het
Gga2 T C 7: 121,596,553 (GRCm39) N408S probably benign Het
Gse1 T C 8: 121,296,043 (GRCm39) V532A unknown Het
Hnrnpul2 T C 19: 8,808,673 (GRCm39) Y712H probably damaging Het
Hpca T C 4: 129,014,019 (GRCm39) probably benign Het
Ifitm3 A G 7: 140,590,372 (GRCm39) F63L probably damaging Het
Inava G T 1: 136,153,135 (GRCm39) C252* probably null Het
Kank1 A T 19: 25,399,525 (GRCm39) T940S probably benign Het
Klhl9 C A 4: 88,640,646 (GRCm39) probably benign Het
Krt36 T C 11: 99,993,786 (GRCm39) M351V probably benign Het
Mthfd2 T C 6: 83,288,830 (GRCm39) N125D probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Ncoa2 A G 1: 13,247,350 (GRCm39) S358P possibly damaging Het
Nmnat1 T C 4: 149,557,808 (GRCm39) H78R probably benign Het
Or10s1 T G 9: 39,986,455 (GRCm39) L288R probably damaging Het
Or5k1 T C 16: 58,617,343 (GRCm39) I289V possibly damaging Het
Or5m13b A T 2: 85,754,146 (GRCm39) Y178F probably damaging Het
Or9r3 A G 10: 129,948,179 (GRCm39) M160T probably benign Het
Pabpc4 A T 4: 123,186,685 (GRCm39) D302V possibly damaging Het
Pgap1 A T 1: 54,582,345 (GRCm39) S167R probably damaging Het
Phf12 T C 11: 77,914,109 (GRCm39) L517P probably benign Het
Rcan2 A G 17: 44,328,689 (GRCm39) D86G probably benign Het
Ryk T C 9: 102,775,715 (GRCm39) Y442H probably damaging Het
Scfd2 G T 5: 74,623,271 (GRCm39) Q421K probably benign Het
Sirpa G T 2: 129,451,072 (GRCm39) V111F probably damaging Het
Skint4 A T 4: 111,975,468 (GRCm39) T143S possibly damaging Het
Slc12a8 C A 16: 33,445,494 (GRCm39) H463N probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Sptlc2 A G 12: 87,388,463 (GRCm39) Y340H probably damaging Het
Ssc5d T A 7: 4,945,745 (GRCm39) W926R possibly damaging Het
Tgfa A G 6: 86,246,944 (GRCm39) E82G probably damaging Het
Thrsp A G 7: 97,066,514 (GRCm39) I66T probably damaging Het
Ttn T C 2: 76,681,988 (GRCm39) E1003G unknown Het
Tube1 A T 10: 39,018,262 (GRCm39) H113L probably benign Het
Uri1 A G 7: 37,681,053 (GRCm39) V117A probably benign Het
Ush2a G A 1: 188,380,606 (GRCm39) C2305Y probably damaging Het
Zbtb7a T G 10: 80,980,010 (GRCm39) V68G probably damaging Het
Zfr T A 15: 12,159,763 (GRCm39) D686E possibly damaging Het
Zscan4f G A 7: 11,135,308 (GRCm39) S238N possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCTGTCTGTTCAGGACCAC -3'
(R):5'- CCAATGAGAACCTACCTCTGGC -3'

Sequencing Primer
(F):5'- GAGTCCTCATCTAGCCTCAAAGTG -3'
(R):5'- AATGAGAACCTACCTCTGGCTTGTC -3'
Posted On 2019-10-24