Incidental Mutation 'R7602:Dhx57'
ID588091
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene NameDEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7602 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location80238304-80290476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80274861 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 438 (N438K)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
Predicted Effect probably benign
Transcript: ENSMUST00000038166
AA Change: N385K

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: N385K

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086555
AA Change: N438K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: N438K

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,178 M114V probably benign Het
1700025G04Rik A T 1: 151,980,515 Y34N probably damaging Het
5730559C18Rik G T 1: 136,225,397 C252* probably null Het
A2m T C 6: 121,642,007 V237A probably damaging Het
A2m A T 6: 121,670,936 D1129V possibly damaging Het
Abca7 A G 10: 79,998,012 probably null Het
Ap3m2 T C 8: 22,792,754 N256S probably benign Het
Atr C T 9: 95,907,383 H1531Y possibly damaging Het
Carmil3 C T 14: 55,501,508 A873V probably null Het
Casp8 A C 1: 58,833,739 K258T probably benign Het
Cast A G 13: 74,736,965 S222P probably benign Het
Cpsf7 C T 19: 10,535,373 P274S probably damaging Het
Ddx24 A T 12: 103,416,260 L688* probably null Het
Ddx59 A G 1: 136,433,821 I475V probably benign Het
Dhx29 T A 13: 112,944,559 S376T possibly damaging Het
Dlk1 T A 12: 109,455,625 probably null Het
Epha6 T C 16: 59,775,568 D920G probably damaging Het
Exo5 A T 4: 120,921,621 V349E probably benign Het
Fam234b T C 6: 135,225,243 V321A possibly damaging Het
Gbp3 A G 3: 142,569,061 E383G probably benign Het
Gga2 T C 7: 121,997,330 N408S probably benign Het
Gm5346 C T 8: 43,626,666 G174R probably damaging Het
Gm8298 T C 3: 59,877,276 I390T probably benign Het
Gse1 T C 8: 120,569,304 V532A unknown Het
Hnrnpul2 T C 19: 8,831,309 Y712H probably damaging Het
Hpca T C 4: 129,120,226 probably benign Het
Ifitm3 A G 7: 141,010,459 F63L probably damaging Het
Kank1 A T 19: 25,422,161 T940S probably benign Het
Klhl9 C A 4: 88,722,409 probably benign Het
Krt36 T C 11: 100,102,960 M351V probably benign Het
Mthfd2 T C 6: 83,311,848 N125D probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Ncoa2 A G 1: 13,177,126 S358P possibly damaging Het
Nmnat1 T C 4: 149,473,351 H78R probably benign Het
Olfr1026 A T 2: 85,923,802 Y178F probably damaging Het
Olfr173 T C 16: 58,796,980 I289V possibly damaging Het
Olfr823 A G 10: 130,112,310 M160T probably benign Het
Olfr982 T G 9: 40,075,159 L288R probably damaging Het
Pabpc4 A T 4: 123,292,892 D302V possibly damaging Het
Pgap1 A T 1: 54,543,186 S167R probably damaging Het
Phf12 T C 11: 78,023,283 L517P probably benign Het
Rcan2 A G 17: 44,017,798 D86G probably benign Het
Ryk T C 9: 102,898,516 Y442H probably damaging Het
Scfd2 G T 5: 74,462,610 Q421K probably benign Het
Sirpa G T 2: 129,609,152 V111F probably damaging Het
Skint4 A T 4: 112,118,271 T143S possibly damaging Het
Slc12a8 C A 16: 33,625,124 H463N probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Sptlc2 A G 12: 87,341,689 Y340H probably damaging Het
Ssc5d T A 7: 4,942,746 W926R possibly damaging Het
Tgfa A G 6: 86,269,962 E82G probably damaging Het
Thrsp A G 7: 97,417,307 I66T probably damaging Het
Ttn T C 2: 76,851,644 E1003G unknown Het
Tube1 A T 10: 39,142,266 H113L probably benign Het
Uri1 A G 7: 37,981,628 V117A probably benign Het
Ush2a G A 1: 188,648,409 C2305Y probably damaging Het
Zbtb7a T G 10: 81,144,176 V68G probably damaging Het
Zfr T A 15: 12,159,677 D686E possibly damaging Het
Zscan4f G A 7: 11,401,381 S238N possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCTGTCTGTTCAGGACCAC -3'
(R):5'- CCAATGAGAACCTACCTCTGGC -3'

Sequencing Primer
(F):5'- GAGTCCTCATCTAGCCTCAAAGTG -3'
(R):5'- AATGAGAACCTACCTCTGGCTTGTC -3'
Posted On2019-10-24