Incidental Mutation 'R7603:Pogk'
ID588097
Institutional Source Beutler Lab
Gene Symbol Pogk
Ensembl Gene ENSMUSG00000040596
Gene Namepogo transposable element with KRAB domain
SynonymsBASS2, 9130401E23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location166384622-166409863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166401911 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 124 (C124R)
Ref Sequence ENSEMBL: ENSMUSP00000120352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127596] [ENSMUST00000128861] [ENSMUST00000131487] [ENSMUST00000135673] [ENSMUST00000148243] [ENSMUST00000169324]
Predicted Effect probably benign
Transcript: ENSMUST00000127596
SMART Domains Protein: ENSMUSP00000120963
Gene: ENSMUSG00000040596

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 105 6.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128861
AA Change: C112R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118270
Gene: ENSMUSG00000040596
AA Change: C112R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131487
AA Change: C112R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116477
Gene: ENSMUSG00000040596
AA Change: C112R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135673
AA Change: C124R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120352
Gene: ENSMUSG00000040596
AA Change: C124R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148243
SMART Domains Protein: ENSMUSP00000118877
Gene: ENSMUSG00000040596

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169324
AA Change: C124R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127395
Gene: ENSMUSG00000040596
AA Change: C124R

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
KRAB 66 126 1.53e-19 SMART
Pfam:BrkDBD 214 266 8.7e-29 PFAM
CENPB 275 342 3.93e-21 SMART
Pfam:DDE_1 414 586 1.5e-48 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known. However, this gene product contains a KRAB domain (which is involved in protein-protein interactions) at the N-terminus, and a transposase domain at the C-terminus, suggesting that it may belong to the family of DNA-mediated transposons in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Pogk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pogk APN 1 166408478 missense probably damaging 1.00
R0395:Pogk UTSW 1 166403602 missense probably damaging 1.00
R1387:Pogk UTSW 1 166400138 missense possibly damaging 0.85
R1556:Pogk UTSW 1 166398833 missense possibly damaging 0.59
R1752:Pogk UTSW 1 166408428 missense probably damaging 0.96
R3625:Pogk UTSW 1 166403512 missense probably damaging 1.00
R3901:Pogk UTSW 1 166403624 missense probably damaging 1.00
R3902:Pogk UTSW 1 166403624 missense probably damaging 1.00
R4288:Pogk UTSW 1 166403506 missense probably damaging 1.00
R4612:Pogk UTSW 1 166398765 nonsense probably null
R5079:Pogk UTSW 1 166399164 missense probably damaging 1.00
R5788:Pogk UTSW 1 166409011 intron probably benign
R6488:Pogk UTSW 1 166399422 missense possibly damaging 0.79
R6708:Pogk UTSW 1 166403509 missense probably damaging 1.00
R8100:Pogk UTSW 1 166401942 missense possibly damaging 0.95
R8950:Pogk UTSW 1 166398825 missense probably damaging 1.00
X0010:Pogk UTSW 1 166398797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACACCAGGTTGCACATG -3'
(R):5'- GAAAGCCCCGACTGACTTTG -3'

Sequencing Primer
(F):5'- CCAGGTTGCACATGAACCAGTAATG -3'
(R):5'- CGACTGACTTTGCTTTGCATC -3'
Posted On2019-10-24