Mutagenetix > Incidental Mutations

Incidental Mutation 'R7603:Ints7'

588099

Institutional Source

Beutler Lab

Gene Symbol

Ints7

Ensembl Gene

ENSMUSG00000037461

Gene Name

integrator complex subunit 7

Synonyms

5930412E23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R7603 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

191575636-191623688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 191596224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 203 (H203L)

Ref Sequence

ENSEMBL: ENSMUSP00000036277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000193569] [ENSMUST00000194785] [ENSMUST00000194877]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000045450
AA Change: H203L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461
AA Change: H203L

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	76	530	1e-10	SMART
low complexity region	937	960	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193569

Predicted Effect

probably benign
Transcript: ENSMUST00000194785

Predicted Effect

probably benign
Transcript: ENSMUST00000194877

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,566,191	T709A	probably benign	Het
Abca6	T	C	11: 110,180,258	K1536E	possibly damaging	Het
Abhd16a	T	A	17: 35,101,960		probably null	Het
Actrt3	C	T	3: 30,598,547	A133T	probably benign	Het
Adcy10	C	T	1: 165,564,237	R1329W	probably damaging	Het
Apol7b	T	C	15: 77,423,456	M280V	possibly damaging	Het
Canx	A	T	11: 50,311,628	D50E	probably benign	Het
Csmd1	A	T	8: 16,288,682	D470E	probably damaging	Het
Cyp2c23	C	T	19: 44,014,930	D269N	probably damaging	Het
Ddah1	T	C	3: 145,759,019	V53A	probably benign	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Fastkd5	A	G	2: 130,615,041	V543A	possibly damaging	Het
Fggy	G	A	4: 95,769,506	G295R	probably damaging	Het
Frs2	T	C	10: 117,074,063	T465A	probably benign	Het
Glipr1	A	T	10: 111,988,832	N156K	probably benign	Het
Gnpnat1	C	T	14: 45,384,617	V40I	probably benign	Het
H2-Q7	T	C	17: 35,439,963	L130P	probably damaging	Het
Herc1	T	A	9: 66,451,383	L86*	probably null	Het
Hspg2	T	C	4: 137,548,368	L2778P	probably damaging	Het
Hspg2	T	A	4: 137,557,192	I3487N	possibly damaging	Het
Htra4	T	G	8: 25,025,700	I441L	probably benign	Het
Lama2	T	C	10: 27,266,680	T601A	possibly damaging	Het
Lin7b	T	C	7: 45,368,432		probably benign	Het
Lmbr1l	G	A	15: 98,908,691	Q280*	probably null	Het
Lpin3	G	T	2: 160,903,754		probably null	Het
Map1lc3b	A	T	8: 121,593,529	H27L	possibly damaging	Het
Mfsd14a	C	A	3: 116,633,883	V369F	probably damaging	Het
Ndufa12	C	T	10: 94,220,779	A123V	probably benign	Het
Nek9	A	G	12: 85,303,514	F929L	probably benign	Het
Nup210	A	T	6: 91,076,697	D279E	probably benign	Het
Olfr553	A	G	7: 102,614,938	V17A	probably benign	Het
Parp1	T	C	1: 180,600,212		probably null	Het
Phc3	T	C	3: 30,907,452	I944V	probably damaging	Het
Phf20	C	T	2: 156,302,851	A793V	probably benign	Het
Phf21a	A	C	2: 92,357,007	R540S	probably benign	Het
Pogk	A	G	1: 166,401,911	C124R	probably benign	Het
Rif1	C	T	2: 52,076,175	S93L	probably damaging	Het
Sele	A	G	1: 164,049,515	E120G	probably damaging	Het
Slc4a1ap	T	C	5: 31,546,195	L49P		Het
Snap47	T	C	11: 59,428,547	D255G	probably damaging	Het
Tcstv3	T	C	13: 120,317,610	V15A	probably damaging	Het
Tmcc1	A	T	6: 116,043,131	Y453*	probably null	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp20	T	A	2: 31,011,474	V459E	probably damaging	Het
Vmn1r202	A	T	13: 22,501,620	L209Q	probably damaging	Het
Vps13b	T	C	15: 35,576,439	S998P	probably damaging	Het

Other mutations in Ints7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ints7	APN	1	191596164	splice site	probably null
IGL01285:Ints7	APN	1	191615778	missense	probably benign	0.00
IGL01289:Ints7	APN	1	191615778	missense	probably benign	0.00
IGL01572:Ints7	APN	1	191615793	missense	possibly damaging	0.71
IGL01665:Ints7	APN	1	191613219	splice site	probably benign
IGL02059:Ints7	APN	1	191615760	missense	probably benign	0.23
IGL02684:Ints7	APN	1	191613637	critical splice acceptor site	probably null
IGL02686:Ints7	APN	1	191586592	missense	probably damaging	1.00
IGL02812:Ints7	APN	1	191619741	missense	probably damaging	1.00
IGL03119:Ints7	APN	1	191610365	missense	probably damaging	1.00
IGL03162:Ints7	APN	1	191621412	utr 3 prime	probably benign
PIT4810001:Ints7	UTSW	1	191596236	missense	probably damaging	0.99
R0294:Ints7	UTSW	1	191611891	missense	possibly damaging	0.91
R0479:Ints7	UTSW	1	191614554	splice site	probably null
R0698:Ints7	UTSW	1	191594464	missense	probably damaging	0.97
R1420:Ints7	UTSW	1	191613057	missense	possibly damaging	0.73
R1680:Ints7	UTSW	1	191621162	splice site	probably null
R1781:Ints7	UTSW	1	191596284	missense	possibly damaging	0.95
R2141:Ints7	UTSW	1	191604860	missense	possibly damaging	0.73
R2291:Ints7	UTSW	1	191606203	splice site	probably null
R4718:Ints7	UTSW	1	191583277	missense	possibly damaging	0.60
R4741:Ints7	UTSW	1	191619635	missense	probably benign	0.29
R4797:Ints7	UTSW	1	191596933	missense	probably damaging	1.00
R4812:Ints7	UTSW	1	191594430	missense	possibly damaging	0.73
R4826:Ints7	UTSW	1	191611906	missense	probably damaging	0.97
R4870:Ints7	UTSW	1	191596331	missense	probably damaging	0.97
R5169:Ints7	UTSW	1	191613090	missense	probably benign	0.00
R5281:Ints7	UTSW	1	191615771	missense	possibly damaging	0.90
R5694:Ints7	UTSW	1	191586618	missense	probably damaging	1.00
R5752:Ints7	UTSW	1	191575893	missense	probably benign	0.00
R6048:Ints7	UTSW	1	191621412	utr 3 prime	probably benign
R6341:Ints7	UTSW	1	191613127	missense	probably damaging	1.00
R6419:Ints7	UTSW	1	191602302	missense	possibly damaging	0.69
R7037:Ints7	UTSW	1	191619605	missense	probably benign	0.16
R7163:Ints7	UTSW	1	191617837	missense	possibly damaging	0.67
R7801:Ints7	UTSW	1	191615747	missense	possibly damaging	0.84
R7899:Ints7	UTSW	1	191621315	missense	probably damaging	1.00
R8034:Ints7	UTSW	1	191613068	frame shift	probably null
R8034:Ints7	UTSW	1	191613071	frame shift	probably null
R8231:Ints7	UTSW	1	191596353	nonsense	probably null
R8251:Ints7	UTSW	1	191621433	missense	unknown
R8520:Ints7	UTSW	1	191582491	missense	probably damaging	1.00
R8966:Ints7	UTSW	1	191619605	missense	probably benign	0.16
R9198:Ints7	UTSW	1	191619760	missense	probably benign	0.42
R9382:Ints7	UTSW	1	191619681	missense	probably damaging	1.00
Z1177:Ints7	UTSW	1	191610458	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CTGTGCCTTTAAAAGCCGTG -3'
(R):5'- GACCCTTGTCAAAGACTCCTTAGC -3'

Sequencing Primer
(F):5'- GGCAGAGCTCTATGATTTCAAGACC -3'
(R):5'- GTGTGTCAACCAAAGAGGA -3'

Posted On

2019-10-24