Incidental Mutation 'R7603:Usp20'
ID 588100
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms Vdu2, 1700055M05Rik
MMRRC Submission 045713-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7603 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 30872291-30912667 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30901486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 459 (V459E)
Ref Sequence ENSEMBL: ENSMUSP00000099913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102849
AA Change: V459E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: V459E

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170476
AA Change: V459E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: V459E

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,071,084 (GRCm39) K1536E possibly damaging Het
Abhd16a T A 17: 35,320,936 (GRCm39) probably null Het
Actrt3 C T 3: 30,652,696 (GRCm39) A133T probably benign Het
Adcy10 C T 1: 165,391,806 (GRCm39) R1329W probably damaging Het
Apol7b T C 15: 77,307,656 (GRCm39) M280V possibly damaging Het
Canx A T 11: 50,202,455 (GRCm39) D50E probably benign Het
Csmd1 A T 8: 16,338,696 (GRCm39) D470E probably damaging Het
Cyp2c23 C T 19: 44,003,369 (GRCm39) D269N probably damaging Het
Ddah1 T C 3: 145,464,774 (GRCm39) V53A probably benign Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Fastkd5 A G 2: 130,456,961 (GRCm39) V543A possibly damaging Het
Fggy G A 4: 95,657,743 (GRCm39) G295R probably damaging Het
Frs2 T C 10: 116,909,968 (GRCm39) T465A probably benign Het
Glipr1 A T 10: 111,824,737 (GRCm39) N156K probably benign Het
Gnpnat1 C T 14: 45,622,074 (GRCm39) V40I probably benign Het
H2-Q7 T C 17: 35,658,939 (GRCm39) L130P probably damaging Het
Herc1 T A 9: 66,358,665 (GRCm39) L86* probably null Het
Hspg2 T C 4: 137,275,679 (GRCm39) L2778P probably damaging Het
Hspg2 T A 4: 137,284,503 (GRCm39) I3487N possibly damaging Het
Htra4 T G 8: 25,515,716 (GRCm39) I441L probably benign Het
Ints7 A T 1: 191,328,336 (GRCm39) H203L probably damaging Het
Lama2 T C 10: 27,142,676 (GRCm39) T601A possibly damaging Het
Lin7b T C 7: 45,017,856 (GRCm39) probably benign Het
Lmbr1l G A 15: 98,806,572 (GRCm39) Q280* probably null Het
Lpin3 G T 2: 160,745,674 (GRCm39) probably null Het
Map1lc3b A T 8: 122,320,268 (GRCm39) H27L possibly damaging Het
Mfsd14a C A 3: 116,427,532 (GRCm39) V369F probably damaging Het
Ndufa12 C T 10: 94,056,641 (GRCm39) A123V probably benign Het
Nek9 A G 12: 85,350,288 (GRCm39) F929L probably benign Het
Nup210 A T 6: 91,053,679 (GRCm39) D279E probably benign Het
Or52m2 A G 7: 102,264,145 (GRCm39) V17A probably benign Het
Parp1 T C 1: 180,427,777 (GRCm39) probably null Het
Phc3 T C 3: 30,961,601 (GRCm39) I944V probably damaging Het
Phf20 C T 2: 156,144,771 (GRCm39) A793V probably benign Het
Phf21a A C 2: 92,187,352 (GRCm39) R540S probably benign Het
Pogk A G 1: 166,229,480 (GRCm39) C124R probably benign Het
Rif1 C T 2: 51,966,187 (GRCm39) S93L probably damaging Het
Sanbr T C 11: 23,516,191 (GRCm39) T709A probably benign Het
Sele A G 1: 163,877,084 (GRCm39) E120G probably damaging Het
Slc4a1ap T C 5: 31,703,539 (GRCm39) L49P Het
Snap47 T C 11: 59,319,373 (GRCm39) D255G probably damaging Het
Tcstv3 T C 13: 120,779,146 (GRCm39) V15A probably damaging Het
Tmcc1 A T 6: 116,020,092 (GRCm39) Y453* probably null Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn1r202 A T 13: 22,685,790 (GRCm39) L209Q probably damaging Het
Vps13b T C 15: 35,576,585 (GRCm39) S998P probably damaging Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 30,894,962 (GRCm39) missense probably damaging 1.00
IGL01444:Usp20 APN 2 30,888,801 (GRCm39) start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 30,901,806 (GRCm39) missense probably benign 0.04
IGL01785:Usp20 APN 2 30,907,175 (GRCm39) missense probably benign 0.02
IGL01786:Usp20 APN 2 30,907,175 (GRCm39) missense probably benign 0.02
IGL02129:Usp20 APN 2 30,894,462 (GRCm39) missense probably benign 0.43
IGL02147:Usp20 APN 2 30,896,413 (GRCm39) missense probably damaging 1.00
IGL03396:Usp20 APN 2 30,901,729 (GRCm39) missense probably benign
BB007:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
BB017:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 30,907,498 (GRCm39) missense possibly damaging 0.47
R0111:Usp20 UTSW 2 30,892,624 (GRCm39) missense probably damaging 1.00
R0369:Usp20 UTSW 2 30,901,116 (GRCm39) missense probably benign 0.00
R0479:Usp20 UTSW 2 30,907,487 (GRCm39) missense probably benign 0.18
R0538:Usp20 UTSW 2 30,894,462 (GRCm39) missense probably damaging 0.99
R1023:Usp20 UTSW 2 30,897,825 (GRCm39) missense probably damaging 1.00
R1183:Usp20 UTSW 2 30,901,797 (GRCm39) missense probably benign 0.17
R1635:Usp20 UTSW 2 30,908,830 (GRCm39) missense probably benign 0.03
R2114:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2115:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2116:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2117:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2232:Usp20 UTSW 2 30,908,750 (GRCm39) missense probably benign 0.13
R2244:Usp20 UTSW 2 30,900,343 (GRCm39) missense possibly damaging 0.65
R2883:Usp20 UTSW 2 30,908,812 (GRCm39) missense probably benign
R4734:Usp20 UTSW 2 30,909,836 (GRCm39) missense probably benign 0.31
R5507:Usp20 UTSW 2 30,900,238 (GRCm39) missense probably benign
R5770:Usp20 UTSW 2 30,907,520 (GRCm39) missense probably damaging 1.00
R5862:Usp20 UTSW 2 30,896,461 (GRCm39) nonsense probably null
R6315:Usp20 UTSW 2 30,907,770 (GRCm39) missense possibly damaging 0.70
R7887:Usp20 UTSW 2 30,910,906 (GRCm39) missense probably benign 0.34
R7930:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
R8542:Usp20 UTSW 2 30,901,636 (GRCm39) missense possibly damaging 0.94
R8965:Usp20 UTSW 2 30,901,797 (GRCm39) missense possibly damaging 0.77
R9079:Usp20 UTSW 2 30,895,120 (GRCm39) intron probably benign
R9226:Usp20 UTSW 2 30,907,412 (GRCm39) missense probably damaging 0.99
R9417:Usp20 UTSW 2 30,873,030 (GRCm39) critical splice acceptor site probably null
R9459:Usp20 UTSW 2 30,901,024 (GRCm39) missense probably damaging 0.99
Z1176:Usp20 UTSW 2 30,909,830 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACCCTTGGAACAGCCTTGG -3'
(R):5'- AATGTCTCCACTGTGGTAGACAC -3'

Sequencing Primer
(F):5'- GGGAGCCCCATTTTATAAACATTAGC -3'
(R):5'- CCTAAATGGTGAAGATCAGCCTGC -3'
Posted On 2019-10-24