Incidental Mutation 'R7603:Phf21a'
ID588102
Institutional Source Beutler Lab
Gene Symbol Phf21a
Ensembl Gene ENSMUSG00000058318
Gene NamePHD finger protein 21A
SynonymsPFTF1, Bhc80, Braf35/HDAC complex (Bhc), 80kDa, D030065N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location92093117-92364666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 92357007 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 540 (R540S)
Ref Sequence ENSEMBL: ENSMUSP00000088074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044036] [ENSMUST00000068702] [ENSMUST00000090586] [ENSMUST00000111290] [ENSMUST00000111291] [ENSMUST00000111292] [ENSMUST00000111293] [ENSMUST00000111294] [ENSMUST00000111297] [ENSMUST00000159961]
Predicted Effect probably benign
Transcript: ENSMUST00000044036
AA Change: R456S

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038497
Gene: ENSMUSG00000058318
AA Change: R456S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068702
AA Change: R408S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000070649
Gene: ENSMUSG00000058318
AA Change: R408S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090586
AA Change: R540S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088074
Gene: ENSMUSG00000058318
AA Change: R540S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111290
AA Change: R511S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106921
Gene: ENSMUSG00000058318
AA Change: R511S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 405 417 4.28e-1 SMART
low complexity region 424 436 N/A INTRINSIC
PHD 470 513 3.12e-15 SMART
RING 471 512 1.85e-1 SMART
coiled coil region 537 582 N/A INTRINSIC
low complexity region 630 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111291
AA Change: R456S

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106922
Gene: ENSMUSG00000058318
AA Change: R456S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111292
AA Change: R408S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106923
Gene: ENSMUSG00000058318
AA Change: R408S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111293
AA Change: R540S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106924
Gene: ENSMUSG00000058318
AA Change: R540S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111294
AA Change: R493S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106925
Gene: ENSMUSG00000058318
AA Change: R493S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
PHD 452 495 3.12e-15 SMART
RING 453 494 1.85e-1 SMART
coiled coil region 519 564 N/A INTRINSIC
low complexity region 612 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111297
AA Change: R463S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106928
Gene: ENSMUSG00000058318
AA Change: R463S

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
PHD 422 465 3.12e-15 SMART
RING 423 464 1.85e-1 SMART
coiled coil region 489 534 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159961
AA Change: R427S

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123955
Gene: ENSMUSG00000058318
AA Change: R427S

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 57 100 N/A INTRINSIC
low complexity region 136 157 N/A INTRINSIC
AT_hook 321 333 4.28e-1 SMART
low complexity region 340 352 N/A INTRINSIC
PHD 386 429 3.12e-15 SMART
RING 387 428 1.85e-1 SMART
coiled coil region 453 498 N/A INTRINSIC
low complexity region 546 566 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124255
Gene: ENSMUSG00000058318
AA Change: R180S

DomainStartEndE-ValueType
PHD 140 183 3.12e-15 SMART
RING 141 182 1.85e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The PHF21A gene encodes BHC80, a component of a BRAF35 (MIM 605535)/histone deacetylase (HDAC; see MIM 601241) complex (BHC) that mediates repression of neuron-specific genes through the cis-regulatory element known as repressor element-1 (RE1) or neural restrictive silencer (NRS) (Hakimi et al., 2002 [PubMed 12032298]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and insufficient milk-sucking behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Phf21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Phf21a APN 2 92348029 missense probably damaging 1.00
IGL00826:Phf21a APN 2 92344536 splice site probably benign
IGL01859:Phf21a APN 2 92328356 missense probably damaging 1.00
IGL02124:Phf21a APN 2 92349422 missense probably damaging 1.00
IGL02724:Phf21a APN 2 92360247 missense probably damaging 1.00
IGL03155:Phf21a APN 2 92320266 missense probably damaging 0.99
R0308:Phf21a UTSW 2 92330777 missense possibly damaging 0.86
R1251:Phf21a UTSW 2 92359199 missense probably benign 0.00
R1739:Phf21a UTSW 2 92360299 missense possibly damaging 0.95
R1775:Phf21a UTSW 2 92330515 missense probably damaging 1.00
R2013:Phf21a UTSW 2 92228483 critical splice donor site probably null
R2064:Phf21a UTSW 2 92327077 missense possibly damaging 0.47
R2073:Phf21a UTSW 2 92348036 missense probably damaging 1.00
R4698:Phf21a UTSW 2 92356952 missense probably damaging 1.00
R4901:Phf21a UTSW 2 92357001 nonsense probably null
R5055:Phf21a UTSW 2 92351856 missense probably damaging 1.00
R5249:Phf21a UTSW 2 92228477 missense probably damaging 1.00
R5401:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R5770:Phf21a UTSW 2 92351854 missense possibly damaging 0.52
R5969:Phf21a UTSW 2 92221611 missense probably damaging 0.98
R6008:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R6012:Phf21a UTSW 2 92351775 missense probably damaging 1.00
R6128:Phf21a UTSW 2 92351608 critical splice acceptor site probably null
R6354:Phf21a UTSW 2 92348937 missense probably damaging 1.00
R7075:Phf21a UTSW 2 92360379 nonsense probably null
R7117:Phf21a UTSW 2 92359157 missense probably benign 0.25
R7270:Phf21a UTSW 2 92327139 missense probably damaging 0.98
R7708:Phf21a UTSW 2 92327166 critical splice donor site probably null
R7946:Phf21a UTSW 2 92359167 missense probably damaging 0.99
Z1177:Phf21a UTSW 2 92230714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTATGTGCAGCCACGGTG -3'
(R):5'- CTGTGAGGAGCAAAGGTTATGCTG -3'

Sequencing Primer
(F):5'- CCACGGTGCAAAAGGTAACATTG -3'
(R):5'- AGCAAAGGTTATGCTGTGTGCC -3'
Posted On2019-10-24