Mutagenetix > Incidental Mutations

Incidental Mutation 'R7603:Epha7'

588109

Institutional Source

Beutler Lab

Gene Symbol

Epha7

Ensembl Gene

ENSMUSG00000028289

Gene Name

Eph receptor A7

Synonyms

Ehk3, Hek11, Cek11, MDK1, Ebk, Mdk1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.552) question?

Stock #

R7603 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28813131-28967499 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 28871937 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 422 (S422L)

Ref Sequence

ENSEMBL: ENSMUSP00000029964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000080934] [ENSMUST00000108191] [ENSMUST00000108194]

Predicted Effect

probably benign
Transcript: ENSMUST00000029964
AA Change: S422L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
Pfam:EphA2_TM	557	630	4.4e-25	PFAM
TyrKc	633	890	8.84e-139	SMART
SAM	920	987	1.26e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080934
AA Change: S422L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000079735
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
transmembrane domain	556	578	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108191
AA Change: S422L

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
Pfam:EphA2_TM	556	626	2.9e-23	PFAM
TyrKc	629	886	8.84e-139	SMART
SAM	916	983	1.26e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108194
AA Change: S422L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
transmembrane domain	556	578	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,566,191	T709A	probably benign	Het
Abca6	T	C	11: 110,180,258	K1536E	possibly damaging	Het
Abhd16a	T	A	17: 35,101,960		probably null	Het
Actrt3	C	T	3: 30,598,547	A133T	probably benign	Het
Adcy10	C	T	1: 165,564,237	R1329W	probably damaging	Het
Apol7b	T	C	15: 77,423,456	M280V	possibly damaging	Het
Canx	A	T	11: 50,311,628	D50E	probably benign	Het
Csmd1	A	T	8: 16,288,682	D470E	probably damaging	Het
Cyp2c23	C	T	19: 44,014,930	D269N	probably damaging	Het
Ddah1	T	C	3: 145,759,019	V53A	probably benign	Het
Fastkd5	A	G	2: 130,615,041	V543A	possibly damaging	Het
Fggy	G	A	4: 95,769,506	G295R	probably damaging	Het
Frs2	T	C	10: 117,074,063	T465A	probably benign	Het
Glipr1	A	T	10: 111,988,832	N156K	probably benign	Het
Gnpnat1	C	T	14: 45,384,617	V40I	probably benign	Het
H2-Q7	T	C	17: 35,439,963	L130P	probably damaging	Het
Herc1	T	A	9: 66,451,383	L86*	probably null	Het
Hspg2	T	C	4: 137,548,368	L2778P	probably damaging	Het
Hspg2	T	A	4: 137,557,192	I3487N	possibly damaging	Het
Htra4	T	G	8: 25,025,700	I441L	probably benign	Het
Ints7	A	T	1: 191,596,224	H203L	probably damaging	Het
Lama2	T	C	10: 27,266,680	T601A	possibly damaging	Het
Lin7b	T	C	7: 45,368,432		probably benign	Het
Lmbr1l	G	A	15: 98,908,691	Q280*	probably null	Het
Lpin3	G	T	2: 160,903,754		probably null	Het
Map1lc3b	A	T	8: 121,593,529	H27L	possibly damaging	Het
Mfsd14a	C	A	3: 116,633,883	V369F	probably damaging	Het
Ndufa12	C	T	10: 94,220,779	A123V	probably benign	Het
Nek9	A	G	12: 85,303,514	F929L	probably benign	Het
Nup210	A	T	6: 91,076,697	D279E	probably benign	Het
Olfr553	A	G	7: 102,614,938	V17A	probably benign	Het
Parp1	T	C	1: 180,600,212		probably null	Het
Phc3	T	C	3: 30,907,452	I944V	probably damaging	Het
Phf20	C	T	2: 156,302,851	A793V	probably benign	Het
Phf21a	A	C	2: 92,357,007	R540S	probably benign	Het
Pogk	A	G	1: 166,401,911	C124R	probably benign	Het
Rif1	C	T	2: 52,076,175	S93L	probably damaging	Het
Sele	A	G	1: 164,049,515	E120G	probably damaging	Het
Slc4a1ap	T	C	5: 31,546,195	L49P		Het
Snap47	T	C	11: 59,428,547	D255G	probably damaging	Het
Tcstv3	T	C	13: 120,317,610	V15A	probably damaging	Het
Tmcc1	A	T	6: 116,043,131	Y453*	probably null	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp20	T	A	2: 31,011,474	V459E	probably damaging	Het
Vmn1r202	A	T	13: 22,501,620	L209Q	probably damaging	Het
Vps13b	T	C	15: 35,576,439	S998P	probably damaging	Het

Other mutations in Epha7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Epha7	APN	4	28961285	intron	probably benign
IGL00849:Epha7	APN	4	28870662	missense	possibly damaging	0.63
IGL00898:Epha7	APN	4	28938693	missense	probably damaging	1.00
IGL02036:Epha7	APN	4	28950509	missense	probably damaging	1.00
IGL02227:Epha7	APN	4	28821587	missense	possibly damaging	0.85
IGL02237:Epha7	APN	4	28949325	splice site	probably null
IGL02376:Epha7	APN	4	28951287	missense	probably damaging	1.00
IGL02424:Epha7	APN	4	28948790	intron	probably benign
IGL02519:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02522:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02524:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02602:Epha7	APN	4	28871877	missense	possibly damaging	0.88
Pump	UTSW	4	28871937	missense	probably benign	0.07
PIT4514001:Epha7	UTSW	4	28961355	nonsense	probably null
R0001:Epha7	UTSW	4	28961279	intron	probably benign
R0011:Epha7	UTSW	4	28962564	missense	probably benign	0.03
R0011:Epha7	UTSW	4	28962564	missense	probably benign	0.03
R0310:Epha7	UTSW	4	28961301	missense	probably benign	0.33
R0373:Epha7	UTSW	4	28935700	splice site	probably null
R0496:Epha7	UTSW	4	28821292	missense	probably damaging	1.00
R0554:Epha7	UTSW	4	28951401	missense	probably damaging	1.00
R0632:Epha7	UTSW	4	28821104	missense	probably damaging	1.00
R1677:Epha7	UTSW	4	28947571	nonsense	probably null
R1883:Epha7	UTSW	4	28950362	missense	possibly damaging	0.58
R1919:Epha7	UTSW	4	28963969	missense	possibly damaging	0.48
R1952:Epha7	UTSW	4	28950474	missense	probably damaging	0.97
R1999:Epha7	UTSW	4	28938686	nonsense	probably null
R2187:Epha7	UTSW	4	28942648	missense	possibly damaging	0.63
R2308:Epha7	UTSW	4	28821503	missense	possibly damaging	0.91
R2417:Epha7	UTSW	4	28947579	missense	probably damaging	1.00
R3911:Epha7	UTSW	4	28938680	missense	probably benign	0.01
R4350:Epha7	UTSW	4	28950393	missense	probably damaging	0.98
R4688:Epha7	UTSW	4	28821367	missense	probably damaging	1.00
R4702:Epha7	UTSW	4	28961425	missense	probably damaging	1.00
R4957:Epha7	UTSW	4	28871892	missense	probably damaging	0.99
R5364:Epha7	UTSW	4	28950557	missense	probably damaging	1.00
R5661:Epha7	UTSW	4	28946217	splice site	probably null
R5820:Epha7	UTSW	4	28949365	missense	probably damaging	1.00
R6038:Epha7	UTSW	4	28821521	missense	probably damaging	1.00
R6038:Epha7	UTSW	4	28821521	missense	probably damaging	1.00
R6592:Epha7	UTSW	4	28813482	critical splice donor site	probably null
R6783:Epha7	UTSW	4	28950528	missense	possibly damaging	0.94
R6991:Epha7	UTSW	4	28821489	missense	probably damaging	1.00
R7152:Epha7	UTSW	4	28935826	missense	possibly damaging	0.94
R7232:Epha7	UTSW	4	28951279	missense	probably damaging	1.00
R7261:Epha7	UTSW	4	28813418	missense	probably benign	0.04
R7365:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7367:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7368:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7413:Epha7	UTSW	4	28871838	missense	probably benign	0.00
R7604:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7605:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7607:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7608:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7609:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7610:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R8073:Epha7	UTSW	4	28821022	missense	probably damaging	1.00
R8263:Epha7	UTSW	4	28821149	missense	probably damaging	1.00
R8334:Epha7	UTSW	4	28938777	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- TACTGTGTAAGCGGTGCAG -3'
(R):5'- CTTTCCCCACCAGAACTATGG -3'

Sequencing Primer
(F):5'- GCGGTGCAGTTGGGAAC -3'
(R):5'- CCAGAACTATGGGGATATTAAATGAC -3'

Posted On

2019-10-24