Incidental Mutation 'R7603:Fggy'
ID588110
Institutional Source Beutler Lab
Gene Symbol Fggy
Ensembl Gene ENSMUSG00000028573
Gene NameFGGY carbohydrate kinase domain containing
Synonyms2310009E04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location95557507-95926939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95769506 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 295 (G295R)
Ref Sequence ENSEMBL: ENSMUSP00000043460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043335] [ENSMUST00000079223] [ENSMUST00000107091] [ENSMUST00000130541] [ENSMUST00000131654] [ENSMUST00000134012]
Predicted Effect probably damaging
Transcript: ENSMUST00000043335
AA Change: G295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043460
Gene: ENSMUSG00000028573
AA Change: G295R

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 1.7e-29 PFAM
Pfam:FGGY_C 290 373 1.9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079223
AA Change: G295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078216
Gene: ENSMUSG00000028573
AA Change: G295R

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 3.3e-27 PFAM
Pfam:FGGY_C 290 498 1.1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107091
AA Change: G207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102706
Gene: ENSMUSG00000028573
AA Change: G207R

DomainStartEndE-ValueType
Pfam:FGGY_N 12 78 1.7e-10 PFAM
Pfam:FGGY_C 202 410 1.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130541
SMART Domains Protein: ENSMUSP00000115688
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_C 1 150 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131654
SMART Domains Protein: ENSMUSP00000116264
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_N 12 82 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134012
SMART Domains Protein: ENSMUSP00000115859
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
SCOP:d1bu6o1 20 107 6e-8 SMART
PDB:3L0Q|B 25 110 2e-24 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Fggy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Fggy APN 4 95837628 missense possibly damaging 0.86
IGL02377:Fggy APN 4 95623477 unclassified probably benign
IGL02417:Fggy APN 4 95849609 missense probably benign 0.01
IGL02527:Fggy APN 4 95697069 missense probably damaging 1.00
IGL02967:Fggy APN 4 95926749 missense possibly damaging 0.74
IGL03053:Fggy APN 4 95926809 unclassified probably benign
IGL03168:Fggy APN 4 95926809 unclassified probably benign
IGL03370:Fggy APN 4 95822064 missense probably damaging 1.00
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0312:Fggy UTSW 4 95844185 missense probably damaging 1.00
R0520:Fggy UTSW 4 95601103 missense probably damaging 1.00
R0747:Fggy UTSW 4 95812100 splice site probably benign
R0940:Fggy UTSW 4 95697001 missense probably benign 0.40
R1513:Fggy UTSW 4 95902058 intron probably benign
R1746:Fggy UTSW 4 95926728 missense probably damaging 1.00
R2998:Fggy UTSW 4 95849585 missense probably benign 0.01
R3848:Fggy UTSW 4 95601124 unclassified probably benign
R4913:Fggy UTSW 4 95697076 critical splice donor site probably null
R5458:Fggy UTSW 4 95926743 missense probably benign
R5868:Fggy UTSW 4 95696988 missense probably damaging 0.99
R6583:Fggy UTSW 4 95600973 missense probably benign 0.01
R6589:Fggy UTSW 4 95597638 missense probably benign 0.00
R7332:Fggy UTSW 4 95623482 missense probably damaging 0.98
R7359:Fggy UTSW 4 95769480 missense probably benign 0.40
R7453:Fggy UTSW 4 95597690 missense probably damaging 1.00
R7806:Fggy UTSW 4 95600966 missense probably benign 0.02
R8072:Fggy UTSW 4 95844157 missense possibly damaging 0.75
R8199:Fggy UTSW 4 95812144 missense probably benign 0.10
R8348:Fggy UTSW 4 95844190 missense probably benign 0.11
R8430:Fggy UTSW 4 95926765 utr 3 prime probably benign
R8448:Fggy UTSW 4 95844190 missense probably benign 0.11
R8503:Fggy UTSW 4 95902058 intron probably benign
R8682:Fggy UTSW 4 95812121 missense probably damaging 1.00
X0067:Fggy UTSW 4 95696992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATACTTCCTAGTTTGCCCTTGG -3'
(R):5'- ACAAGTTGGCCACTGGAAAG -3'

Sequencing Primer
(F):5'- GCCCTTGGCTAGCAAGTAAATTTTTG -3'
(R):5'- CCACTGGAAAGAGGCTTGGC -3'
Posted On2019-10-24