Mutagenetix > Incidental Mutations

Incidental Mutation 'R7603:Nup210'

588114

Institutional Source

Beutler Lab

Gene Symbol

Nup210

Ensembl Gene

ENSMUSG00000030091

Gene Name

nucleoporin 210

Synonyms

gp190, Pom210, gp210

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7603 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91013068-91116829 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 91076697 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 279 (D279E)

Ref Sequence

ENSEMBL: ENSMUSP00000032179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509]

Predicted Effect

probably benign
Transcript: ENSMUST00000032179
AA Change: D279E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091
AA Change: D279E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Blast:BID_2	450	527	3e-29	BLAST
low complexity region	850	862	N/A	INTRINSIC
Blast:S1	937	1022	6e-37	BLAST
BID_2	1077	1152	8.36e-6	SMART
low complexity region	1159	1168	N/A	INTRINSIC
Blast:BID_2	1468	1551	3e-35	BLAST
transmembrane domain	1809	1831	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113509
AA Change: D279E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091
AA Change: D279E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Blast:BID_2	450	527	4e-29	BLAST
low complexity region	806	818	N/A	INTRINSIC
Blast:S1	893	978	4e-37	BLAST
BID_2	1033	1108	8.36e-6	SMART
low complexity region	1115	1124	N/A	INTRINSIC
Blast:BID_2	1424	1507	3e-35	BLAST
transmembrane domain	1765	1787	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,566,191	T709A	probably benign	Het
Abca6	T	C	11: 110,180,258	K1536E	possibly damaging	Het
Abhd16a	T	A	17: 35,101,960		probably null	Het
Actrt3	C	T	3: 30,598,547	A133T	probably benign	Het
Adcy10	C	T	1: 165,564,237	R1329W	probably damaging	Het
Apol7b	T	C	15: 77,423,456	M280V	possibly damaging	Het
Canx	A	T	11: 50,311,628	D50E	probably benign	Het
Csmd1	A	T	8: 16,288,682	D470E	probably damaging	Het
Cyp2c23	C	T	19: 44,014,930	D269N	probably damaging	Het
Ddah1	T	C	3: 145,759,019	V53A	probably benign	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Fastkd5	A	G	2: 130,615,041	V543A	possibly damaging	Het
Fggy	G	A	4: 95,769,506	G295R	probably damaging	Het
Frs2	T	C	10: 117,074,063	T465A	probably benign	Het
Glipr1	A	T	10: 111,988,832	N156K	probably benign	Het
Gnpnat1	C	T	14: 45,384,617	V40I	probably benign	Het
H2-Q7	T	C	17: 35,439,963	L130P	probably damaging	Het
Herc1	T	A	9: 66,451,383	L86*	probably null	Het
Hspg2	T	C	4: 137,548,368	L2778P	probably damaging	Het
Hspg2	T	A	4: 137,557,192	I3487N	possibly damaging	Het
Htra4	T	G	8: 25,025,700	I441L	probably benign	Het
Ints7	A	T	1: 191,596,224	H203L	probably damaging	Het
Lama2	T	C	10: 27,266,680	T601A	possibly damaging	Het
Lin7b	T	C	7: 45,368,432		probably benign	Het
Lmbr1l	G	A	15: 98,908,691	Q280*	probably null	Het
Lpin3	G	T	2: 160,903,754		probably null	Het
Map1lc3b	A	T	8: 121,593,529	H27L	possibly damaging	Het
Mfsd14a	C	A	3: 116,633,883	V369F	probably damaging	Het
Ndufa12	C	T	10: 94,220,779	A123V	probably benign	Het
Nek9	A	G	12: 85,303,514	F929L	probably benign	Het
Olfr553	A	G	7: 102,614,938	V17A	probably benign	Het
Parp1	T	C	1: 180,600,212		probably null	Het
Phc3	T	C	3: 30,907,452	I944V	probably damaging	Het
Phf20	C	T	2: 156,302,851	A793V	probably benign	Het
Phf21a	A	C	2: 92,357,007	R540S	probably benign	Het
Pogk	A	G	1: 166,401,911	C124R	probably benign	Het
Rif1	C	T	2: 52,076,175	S93L	probably damaging	Het
Sele	A	G	1: 164,049,515	E120G	probably damaging	Het
Slc4a1ap	T	C	5: 31,546,195	L49P		Het
Snap47	T	C	11: 59,428,547	D255G	probably damaging	Het
Tcstv3	T	C	13: 120,317,610	V15A	probably damaging	Het
Tmcc1	A	T	6: 116,043,131	Y453*	probably null	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp20	T	A	2: 31,011,474	V459E	probably damaging	Het
Vmn1r202	A	T	13: 22,501,620	L209Q	probably damaging	Het
Vps13b	T	C	15: 35,576,439	S998P	probably damaging	Het

Other mutations in Nup210

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01139:Nup210	APN	6	91030097	missense	possibly damaging	0.92
IGL01532:Nup210	APN	6	91085999	splice site	probably benign
IGL01574:Nup210	APN	6	91040564	missense	probably benign	0.35
IGL01621:Nup210	APN	6	91030117	missense	probably damaging	1.00
IGL01976:Nup210	APN	6	91053614	missense	possibly damaging	0.89
IGL02089:Nup210	APN	6	91076698	missense	probably benign	0.04
IGL02291:Nup210	APN	6	91101268	missense	probably damaging	1.00
IGL03013:Nup210	APN	6	91053379	missense	probably benign	0.00
IGL03046:Nup210	APN	6	91018996	splice site	probably benign
IGL03136:Nup210	APN	6	91028861	missense	probably benign	0.32
IGL03139:Nup210	APN	6	91020239	missense	probably benign	0.08
IGL03195:Nup210	APN	6	91015850	missense	probably benign	0.32
IGL03344:Nup210	APN	6	91021429	missense	possibly damaging	0.53
brotherhood	UTSW	6	91036469	missense	possibly damaging	0.81
equality	UTSW	6	91021395	critical splice donor site	probably null
Liberty	UTSW	6	91020180	missense	probably benign	0.04
unity	UTSW	6	91031668	nonsense	probably null
IGL03134:Nup210	UTSW	6	91030190	missense	probably damaging	0.99
PIT4810001:Nup210	UTSW	6	91030124	missense	probably damaging	1.00
R0100:Nup210	UTSW	6	91069193	missense	probably benign	0.04
R0348:Nup210	UTSW	6	91074310	missense	probably benign	0.27
R0385:Nup210	UTSW	6	91028795	missense	possibly damaging	0.77
R0551:Nup210	UTSW	6	91021484	missense	possibly damaging	0.85
R0606:Nup210	UTSW	6	91026929	missense	possibly damaging	0.89
R1053:Nup210	UTSW	6	91028811	missense	probably benign	0.41
R1301:Nup210	UTSW	6	91042347	missense	possibly damaging	0.47
R1381:Nup210	UTSW	6	91075960	missense	probably damaging	0.99
R1464:Nup210	UTSW	6	91053569	missense	possibly damaging	0.82
R1464:Nup210	UTSW	6	91053569	missense	possibly damaging	0.82
R1487:Nup210	UTSW	6	91042576	missense	probably damaging	1.00
R1522:Nup210	UTSW	6	91069166	missense	possibly damaging	0.85
R1529:Nup210	UTSW	6	91036376	missense	probably damaging	1.00
R1531:Nup210	UTSW	6	91034841	missense	probably benign	0.05
R1668:Nup210	UTSW	6	91028805	missense	possibly damaging	0.89
R1694:Nup210	UTSW	6	91062803	missense	probably benign	0.09
R1803:Nup210	UTSW	6	91074282	missense	probably damaging	0.99
R1851:Nup210	UTSW	6	91016054	missense	probably damaging	1.00
R2145:Nup210	UTSW	6	91028876	missense	possibly damaging	0.81
R2196:Nup210	UTSW	6	91055244	missense	probably benign	0.02
R2308:Nup210	UTSW	6	91040868	missense	probably benign	0.19
R2419:Nup210	UTSW	6	91017556	splice site	probably benign
R2912:Nup210	UTSW	6	91026974	missense	probably damaging	1.00
R3413:Nup210	UTSW	6	91025242	missense	probably benign	0.00
R3718:Nup210	UTSW	6	91020180	missense	probably benign	0.04
R3753:Nup210	UTSW	6	91021395	critical splice donor site	probably null
R4058:Nup210	UTSW	6	91060620	missense	probably benign	0.02
R4840:Nup210	UTSW	6	91031668	nonsense	probably null
R4912:Nup210	UTSW	6	91017529	missense	probably benign	0.01
R4967:Nup210	UTSW	6	91036469	missense	possibly damaging	0.81
R4996:Nup210	UTSW	6	91053436	missense	probably benign	0.16
R5074:Nup210	UTSW	6	91055327	missense	probably benign	0.16
R5233:Nup210	UTSW	6	91026969	missense	probably damaging	1.00
R5352:Nup210	UTSW	6	91069316	missense	probably damaging	1.00
R5490:Nup210	UTSW	6	91085988	missense	probably damaging	0.98
R5511:Nup210	UTSW	6	91026963	missense	probably damaging	0.97
R5773:Nup210	UTSW	6	91085883	missense	probably damaging	0.96
R6064:Nup210	UTSW	6	91055291	missense	probably benign	0.01
R6209:Nup210	UTSW	6	91025355	missense	probably benign
R6299:Nup210	UTSW	6	91074288	missense	possibly damaging	0.68
R6705:Nup210	UTSW	6	91087960	missense	possibly damaging	0.50
R6855:Nup210	UTSW	6	91040853	missense	probably benign	0.13
R6856:Nup210	UTSW	6	91087913	nonsense	probably null
R6911:Nup210	UTSW	6	91030130	missense	probably damaging	0.98
R6955:Nup210	UTSW	6	91087927	missense	probably damaging	1.00
R7045:Nup210	UTSW	6	91054451	missense	probably damaging	1.00
R7081:Nup210	UTSW	6	91060665	missense	possibly damaging	0.50
R7163:Nup210	UTSW	6	91073331	missense	probably damaging	1.00
R7305:Nup210	UTSW	6	91087966	missense	probably damaging	1.00
R7387:Nup210	UTSW	6	91021396	critical splice donor site	probably null
R7404:Nup210	UTSW	6	91073245	missense	probably benign	0.01
R7469:Nup210	UTSW	6	91018892	missense	probably benign	0.08
R7731:Nup210	UTSW	6	91071888	missense	possibly damaging	0.50
R7822:Nup210	UTSW	6	91018777	missense	possibly damaging	0.71
R7944:Nup210	UTSW	6	91073197	missense	probably damaging	0.99
R8032:Nup210	UTSW	6	91074349	missense	probably benign	0.02
R8039:Nup210	UTSW	6	91070233	missense	probably benign	0.09
R8081:Nup210	UTSW	6	91076675	missense	probably benign	0.00
R8177:Nup210	UTSW	6	91014488	missense	probably benign
R8331:Nup210	UTSW	6	91053666	missense	possibly damaging	0.49
R8356:Nup210	UTSW	6	91074348	missense	probably benign	0.32
R8530:Nup210	UTSW	6	91076645	missense	possibly damaging	0.51
X0067:Nup210	UTSW	6	91074280	missense	probably damaging	1.00
Z1177:Nup210	UTSW	6	91020185	missense	probably benign
Z1177:Nup210	UTSW	6	91087907	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGTCCTGGCTGGCTTTAAGG -3'
(R):5'- AAGAGCTTGCTCACTTCGG -3'

Sequencing Primer
(F):5'- TTAAGGGAGAAAAACAACTTGGCTTC -3'
(R):5'- GTTCACCACTGCTAGCAT -3'

Posted On

2019-10-24