Incidental Mutation 'R7603:Olfr553'
ID 588116
Institutional Source Beutler Lab
Gene Symbol Olfr553
Ensembl Gene ENSMUSG00000073972
Gene Name olfactory receptor 553
Synonyms MOR25-2, GA_x6K02T2PBJ9-5333671-5332712
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7603 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102611281-102618218 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102614938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000149901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098222] [ENSMUST00000216776]
AlphaFold Q7TRS6
Predicted Effect probably benign
Transcript: ENSMUST00000098222
AA Change: V17A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095825
Gene: ENSMUSG00000073972
AA Change: V17A

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 1.1e-108 PFAM
Pfam:7TM_GPCR_Srsx 44 158 1.3e-9 PFAM
Pfam:7tm_1 50 302 4.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216776
AA Change: V17A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Olfr553
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Olfr553 APN 7 102614172 missense probably benign 0.18
IGL01957:Olfr553 APN 7 102614339 missense probably damaging 0.98
IGL02720:Olfr553 APN 7 102614839 missense probably damaging 1.00
IGL03052:Olfr553 UTSW 7 102614449 missense probably benign 0.00
R1812:Olfr553 UTSW 7 102614370 missense possibly damaging 0.95
R1994:Olfr553 UTSW 7 102614540 missense probably damaging 0.97
R3406:Olfr553 UTSW 7 102614786 missense possibly damaging 0.92
R4575:Olfr553 UTSW 7 102614769 nonsense probably null
R5527:Olfr553 UTSW 7 102614561 missense probably benign
R6823:Olfr553 UTSW 7 102614486 missense probably damaging 0.99
R7224:Olfr553 UTSW 7 102614767 missense probably damaging 1.00
R7823:Olfr553 UTSW 7 102614957 missense probably benign 0.00
R8260:Olfr553 UTSW 7 102614225 missense possibly damaging 0.91
R8542:Olfr553 UTSW 7 102614665 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATTGTAGAAGTTGACAGGAC -3'
(R):5'- GTGACCTTTCAAGTTGGCTTTC -3'

Sequencing Primer
(F):5'- TTGTAGAAGTTGACAGGACCAAGTC -3'
(R):5'- ACCTTTCAAGTTGGCTTTCTAAATTC -3'
Posted On 2019-10-24