Incidental Mutation 'R7603:Htra4'
ID588118
Institutional Source Beutler Lab
Gene Symbol Htra4
Ensembl Gene ENSMUSG00000037406
Gene NameHtrA serine peptidase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25024929-25038962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25025700 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 441 (I441L)
Ref Sequence ENSEMBL: ENSMUSP00000081044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033961] [ENSMUST00000084031] [ENSMUST00000210536] [ENSMUST00000210758]
Predicted Effect probably benign
Transcript: ENSMUST00000033961
SMART Domains Protein: ENSMUSP00000033961
Gene: ENSMUSG00000031556

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:TM2 145 194 1.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084031
AA Change: I441L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000081044
Gene: ENSMUSG00000037406
AA Change: I441L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IB 37 112 5.44e-7 SMART
KAZAL 109 158 7.92e-4 SMART
Pfam:Trypsin 182 368 5.5e-15 PFAM
Pfam:Trypsin_2 208 346 2.1e-34 PFAM
PDZ 385 470 5.34e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210536
Predicted Effect probably benign
Transcript: ENSMUST00000210758
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HtrA family of proteases. The encoded protein contains a putative signal peptide, an insulin growth factor binding domain, a Kazal protease inhibitor domain, a conserved trypsin domain and a PDZ domain. Based on studies on other related family members, this enzyme may function as a secreted oligomeric chaperone protease to degrade misfolded secretory proteins. Other human HtrA proteins have been implicated in arthritis, tumor suppression, unfolded stress response, apoptosis, and aging. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Htra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Htra4 APN 8 25033571 missense probably damaging 0.98
IGL01738:Htra4 APN 8 25025711 missense probably damaging 0.96
IGL02307:Htra4 APN 8 25033694 missense probably damaging 1.00
IGL03382:Htra4 APN 8 25029698 missense probably benign 0.17
R0057:Htra4 UTSW 8 25038808 missense probably benign
R0906:Htra4 UTSW 8 25037144 missense probably benign 0.00
R1075:Htra4 UTSW 8 25033596 missense probably benign 0.00
R1173:Htra4 UTSW 8 25030619 missense possibly damaging 0.92
R1180:Htra4 UTSW 8 25033719 missense probably damaging 1.00
R1854:Htra4 UTSW 8 25033581 missense probably damaging 1.00
R2030:Htra4 UTSW 8 25033577 missense probably damaging 1.00
R2225:Htra4 UTSW 8 25025720 missense probably benign 0.42
R4457:Htra4 UTSW 8 25038658 missense possibly damaging 0.90
R4626:Htra4 UTSW 8 25037114 missense probably benign 0.29
R4746:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R4797:Htra4 UTSW 8 25033659 missense probably damaging 1.00
R5369:Htra4 UTSW 8 25033569 missense possibly damaging 0.95
R6846:Htra4 UTSW 8 25030545 missense probably damaging 1.00
R6911:Htra4 UTSW 8 25025705 missense probably damaging 0.96
R7067:Htra4 UTSW 8 25033701 missense probably damaging 1.00
R7367:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R7446:Htra4 UTSW 8 25037165 missense probably benign 0.09
R7725:Htra4 UTSW 8 25037153 missense possibly damaging 0.94
R7729:Htra4 UTSW 8 25037077 missense possibly damaging 0.63
R7893:Htra4 UTSW 8 25033679 missense possibly damaging 0.81
R7988:Htra4 UTSW 8 25030510 critical splice donor site probably null
R8140:Htra4 UTSW 8 25030558 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGGCACCTCTTCGATACAAAAC -3'
(R):5'- CCAAATGGGGATGACTAGAACTC -3'

Sequencing Primer
(F):5'- CAGGTGTGACTGTCAGAA -3'
(R):5'- AATGGGGATGACTAGAACTCTTCTTG -3'
Posted On2019-10-24