Incidental Mutation 'R7603:Map1lc3b'
ID588119
Institutional Source Beutler Lab
Gene Symbol Map1lc3b
Ensembl Gene ENSMUSG00000031812
Gene Namemicrotubule-associated protein 1 light chain 3 beta
SynonymsLC3b, Atg8, 1010001C15Rik, Map1lc3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location121590361-121598760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121593529 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 27 (H27L)
Ref Sequence ENSEMBL: ENSMUSP00000034270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034270] [ENSMUST00000127664] [ENSMUST00000181521] [ENSMUST00000181826] [ENSMUST00000181948]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034270
AA Change: H27L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034270
Gene: ENSMUSG00000031812
AA Change: H27L

DomainStartEndE-ValueType
Pfam:Atg8 15 120 5.8e-47 PFAM
Pfam:APG12 33 120 8.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181521
SMART Domains Protein: ENSMUSP00000137996
Gene: ENSMUSG00000031812

DomainStartEndE-ValueType
Pfam:Atg8 1 61 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181826
Predicted Effect probably damaging
Transcript: ENSMUST00000181948
AA Change: H27L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137754
Gene: ENSMUSG00000031812
AA Change: H27L

DomainStartEndE-ValueType
Pfam:Atg8 60 155 2.6e-38 PFAM
Pfam:APG12 68 155 2.8e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of neuronal microtubule-associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. Studies on the rat homolog implicate a role for this gene in autophagy, a process that involves the bulk degradation of cytoplasmic component. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop, breed and behave normally and display a normal life span. In culture, mutant MEFs maintain wild-type levels of fibronectin (FN) protein despite reduced FN synthesis, and show normal induction of autophagosomes under starvation conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Map1lc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02709:Map1lc3b APN 8 121596029 missense probably damaging 1.00
apollo UTSW 8 121596720 missense probably benign 0.38
R0201:Map1lc3b UTSW 8 121590550 missense possibly damaging 0.78
R1395:Map1lc3b UTSW 8 121596720 missense probably benign 0.38
R1496:Map1lc3b UTSW 8 121596600 missense possibly damaging 0.47
R1769:Map1lc3b UTSW 8 121593487 splice site probably benign
R2571:Map1lc3b UTSW 8 121593474 intron probably null
R6272:Map1lc3b UTSW 8 121596690 missense probably benign 0.31
R6788:Map1lc3b UTSW 8 121593577 missense probably benign
R7406:Map1lc3b UTSW 8 121590616 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAGCAGCCCCTTTGCAACAAG -3'
(R):5'- ATGCCAGCACTGACTAGCATAG -3'

Sequencing Primer
(F):5'- TTTGCAACAAGGGCTTTACC -3'
(R):5'- ACAGCTGGAGTGCAGTTCAGTC -3'
Posted On2019-10-24