Incidental Mutation 'R7603:Glipr1'
ID588123
Institutional Source Beutler Lab
Gene Symbol Glipr1
Ensembl Gene ENSMUSG00000056888
Gene NameGLI pathogenesis-related 1 (glioma)
SynonymsRTVP1, RTVP-1, 2410114O14Rik, mRTVP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location111985448-112002631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111988832 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 156 (N156K)
Ref Sequence ENSEMBL: ENSMUSP00000074359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074805] [ENSMUST00000161870] [ENSMUST00000162508] [ENSMUST00000163048] [ENSMUST00000174653]
Predicted Effect probably benign
Transcript: ENSMUST00000074805
AA Change: N156K

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074359
Gene: ENSMUSG00000056888
AA Change: N156K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161870
AA Change: N34K

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134094
Gene: ENSMUSG00000056888
AA Change: N34K

DomainStartEndE-ValueType
Pfam:CAP 1 42 9.2e-10 PFAM
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162508
AA Change: N156K

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123990
Gene: ENSMUSG00000056888
AA Change: N156K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163048
SMART Domains Protein: ENSMUSP00000125746
Gene: ENSMUSG00000063334

DomainStartEndE-ValueType
KH 138 210 4.85e-6 SMART
low complexity region 246 264 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
low complexity region 339 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174653
SMART Domains Protein: ENSMUSP00000134408
Gene: ENSMUSG00000063334

DomainStartEndE-ValueType
KH 138 210 4.85e-6 SMART
low complexity region 265 277 N/A INTRINSIC
low complexity region 282 306 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to both the pathogenesis-related protein (PR) superfamily and the cysteine-rich secretory protein (CRISP) family. Increased expression of this gene is associated with myelomocytic differentiation in macrophage and decreased expression of this gene through gene methylation is associated with prostate cancer. The protein has proapoptotic activities in prostate and bladder cancer cells. This gene is a member of a cluster on chromosome 12 containing two other similar genes. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene renders mice more vulnerable to spontaneous tumorigenesis, leading to the formation of a wide spectrum of tumors and significantly shorter tumor-free survival times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Glipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Glipr1 APN 10 111985650 missense probably benign
IGL00553:Glipr1 APN 10 111986669 missense possibly damaging 0.79
IGL02391:Glipr1 APN 10 111988894 unclassified probably benign
R0115:Glipr1 UTSW 10 111993541 missense probably benign 0.00
R0486:Glipr1 UTSW 10 111996849 splice site probably benign
R1349:Glipr1 UTSW 10 111993532 missense probably benign 0.02
R1822:Glipr1 UTSW 10 111996860 missense possibly damaging 0.84
R4364:Glipr1 UTSW 10 111985637 missense possibly damaging 0.84
R4905:Glipr1 UTSW 10 111985640 missense probably damaging 1.00
R4974:Glipr1 UTSW 10 111993506 nonsense probably null
R5734:Glipr1 UTSW 10 111985793 nonsense probably null
R8238:Glipr1 UTSW 10 111993440 critical splice donor site probably null
Z1176:Glipr1 UTSW 10 111988837 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGTGTGTATAAACATACCCACACAG -3'
(R):5'- CACACTGTTCTGAGACTGTAACTC -3'

Sequencing Primer
(F):5'- CCCACACAGTATTAATGTAGTAAGTC -3'
(R):5'- CCAGCTGAGTTCTGAGTGCTTAAC -3'
Posted On2019-10-24