Incidental Mutation 'R7603:0610010F05Rik'
List |< first << previous [record 47 of 463022] next >> last >|
ID588125
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R7603 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location23564961-23633639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23566191 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 709 (T709A)
Ref Sequence ENSEMBL: ENSMUSP00000137799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000155903]
Predicted Effect probably benign
Transcript: ENSMUST00000155903
AA Change: T709A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208
AA Change: T709A

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice site probably benign
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably benign 0.29
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 0.99
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense probably benign 0.45
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 0.99
R1568:0610010F05Rik UTSW 11 23589971 missense probably damaging 1.00
R2163:0610010F05Rik UTSW 11 23576826 splice site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 splice site probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
R6758:0610010F05Rik UTSW 11 23588475 intron probably null
R6860:0610010F05Rik UTSW 11 23625100 missense probably damaging 1.00
R6910:0610010F05Rik UTSW 11 23620447 missense probably damaging 0.99
R7255:0610010F05Rik UTSW 11 23620465 missense probably benign 0.41
R7286:0610010F05Rik UTSW 11 23622479 missense probably benign 0.07
R7618:0610010F05Rik UTSW 11 23584550 missense possibly damaging 0.91
R7717:0610010F05Rik UTSW 11 23606757 missense probably benign 0.05
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGCTCACTGTTTTACTTCACAAG -3'
(R):5'- ATGGTATGGCTGACCTGGAAC -3'

Sequencing Primer
(F):5'- TGGGTACTGCATACACACTCATG -3'
(R):5'- GCTGGCTATTCTAGAACTAACTCGG -3'
Posted On2019-10-24