Incidental Mutation 'R7603:Snap47'
ID588127
Institutional Source Beutler Lab
Gene Symbol Snap47
Ensembl Gene ENSMUSG00000009894
Gene Namesynaptosomal-associated protein, 47
SynonymsSNAP-47, 1110031B06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location59407134-59451186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59428547 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 255 (D255G)
Ref Sequence ENSEMBL: ENSMUSP00000010038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010038] [ENSMUST00000120940] [ENSMUST00000136436] [ENSMUST00000156146]
Predicted Effect probably damaging
Transcript: ENSMUST00000010038
AA Change: D255G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010038
Gene: ENSMUSG00000009894
AA Change: D255G

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120940
AA Change: D255G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113555
Gene: ENSMUSG00000009894
AA Change: D255G

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136436
SMART Domains Protein: ENSMUSP00000115762
Gene: ENSMUSG00000009894

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156146
SMART Domains Protein: ENSMUSP00000121880
Gene: ENSMUSG00000009894

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Snap47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Snap47 APN 11 59421651 critical splice acceptor site probably null
IGL02113:Snap47 APN 11 59428436 missense probably damaging 0.99
IGL03290:Snap47 APN 11 59428598 missense probably damaging 1.00
R0126:Snap47 UTSW 11 59437987 missense probably damaging 0.99
R0582:Snap47 UTSW 11 59428433 nonsense probably null
R0633:Snap47 UTSW 11 59428613 missense probably benign 0.25
R0883:Snap47 UTSW 11 59438500 utr 5 prime probably benign
R1657:Snap47 UTSW 11 59428770 missense probably benign 0.08
R1855:Snap47 UTSW 11 59428333 unclassified probably benign
R2761:Snap47 UTSW 11 59438059 missense probably benign 0.01
R4079:Snap47 UTSW 11 59428551 missense probably benign 0.38
R4805:Snap47 UTSW 11 59428517 missense possibly damaging 0.91
R4960:Snap47 UTSW 11 59428543 missense probably damaging 1.00
R5212:Snap47 UTSW 11 59428352 missense probably damaging 0.99
R5793:Snap47 UTSW 11 59438192 missense probably damaging 1.00
R7243:Snap47 UTSW 11 59428722 missense probably benign 0.04
R7870:Snap47 UTSW 11 59438078 missense probably benign 0.11
R8001:Snap47 UTSW 11 59438354 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACCTTGTTCCTGAGCACTAAG -3'
(R):5'- CTAAGTTTTGGAAGATGCCGGC -3'

Sequencing Primer
(F):5'- TGAGCACTAAGGCGTCTTC -3'
(R):5'- AATCTCAAGGAAGGTGTGTCTTC -3'
Posted On2019-10-24