Incidental Mutation 'R7603:Apol7b'
ID588134
Institutional Source Beutler Lab
Gene Symbol Apol7b
Ensembl Gene ENSMUSG00000068252
Gene Nameapolipoprotein L 7b
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7603 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location77422209-77447492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77423456 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 280 (M280V)
Ref Sequence ENSEMBL: ENSMUSP00000086894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089469] [ENSMUST00000229434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089469
AA Change: M280V

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086894
Gene: ENSMUSG00000068252
AA Change: M280V

DomainStartEndE-ValueType
Pfam:ApoL 20 82 7.9e-15 PFAM
Pfam:ApoL 77 367 1.9e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229434
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Apol7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Apol7b APN 15 77423914 missense probably damaging 1.00
IGL02081:Apol7b APN 15 77423536 missense possibly damaging 0.83
IGL02350:Apol7b APN 15 77423632 missense probably benign 0.05
IGL02357:Apol7b APN 15 77423632 missense probably benign 0.05
R0506:Apol7b UTSW 15 77425528 missense probably benign 0.02
R1187:Apol7b UTSW 15 77423403 missense possibly damaging 0.94
R1433:Apol7b UTSW 15 77425546 missense probably damaging 1.00
R1978:Apol7b UTSW 15 77423339 missense probably damaging 0.99
R2272:Apol7b UTSW 15 77423710 missense probably damaging 1.00
R4012:Apol7b UTSW 15 77424709 missense probably damaging 0.98
R4485:Apol7b UTSW 15 77423666 missense probably benign
R4571:Apol7b UTSW 15 77423534 missense probably benign 0.01
R4823:Apol7b UTSW 15 77427782 utr 5 prime probably benign
R5018:Apol7b UTSW 15 77424716 missense probably benign 0.03
R5944:Apol7b UTSW 15 77423767 missense probably damaging 0.99
R6514:Apol7b UTSW 15 77423926 missense probably benign 0.00
R6519:Apol7b UTSW 15 77423348 missense probably benign 0.01
R6808:Apol7b UTSW 15 77424673 missense probably damaging 1.00
R6904:Apol7b UTSW 15 77423425 missense probably benign 0.09
R7570:Apol7b UTSW 15 77423474 missense probably benign 0.00
R7571:Apol7b UTSW 15 77423477 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCTAGGTCCTGAGCCTGATG -3'
(R):5'- CTGAAGCTAAAGCCAGCAAG -3'

Sequencing Primer
(F):5'- TGCAGCAGACTCAGCCTTTG -3'
(R):5'- AGCAAGCTGGTGCCAAC -3'
Posted On2019-10-24