Incidental Mutation 'R7603:Lmbr1l'
ID588135
Institutional Source Beutler Lab
Gene Symbol Lmbr1l
Ensembl Gene ENSMUSG00000022999
Gene Namelimb region 1 like
Synonyms1110013E13Rik, D15Ertd735e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98903917-98918231 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 98908691 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 280 (Q280*)
Ref Sequence ENSEMBL: ENSMUSP00000023736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023736]
Predicted Effect probably null
Transcript: ENSMUST00000023736
AA Change: Q280*
SMART Domains Protein: ENSMUSP00000023736
Gene: ENSMUSG00000022999
AA Change: Q280*

DomainStartEndE-ValueType
Pfam:LMBR1 28 269 2e-41 PFAM
Pfam:LMBR1 266 450 1.2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Lmbr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Lmbr1l APN 15 98904785 missense probably damaging 1.00
IGL02097:Lmbr1l APN 15 98917891 missense probably damaging 0.98
IGL02731:Lmbr1l APN 15 98917896 missense probably damaging 0.96
finch UTSW 15 98909386 critical splice donor site probably null
Gooseberry UTSW 15 98912427 missense probably damaging 0.99
morula UTSW 15 98904791 missense probably damaging 1.00
strawberry UTSW 15 98909263 nonsense probably null
R0310:Lmbr1l UTSW 15 98908773 splice site probably benign
R1778:Lmbr1l UTSW 15 98912476 missense probably damaging 1.00
R2418:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R2419:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R4181:Lmbr1l UTSW 15 98908720 missense possibly damaging 0.94
R4379:Lmbr1l UTSW 15 98909263 nonsense probably null
R4472:Lmbr1l UTSW 15 98906297 missense probably benign 0.02
R5290:Lmbr1l UTSW 15 98912242 missense probably damaging 1.00
R5410:Lmbr1l UTSW 15 98909262 missense probably damaging 1.00
R5436:Lmbr1l UTSW 15 98904791 missense probably damaging 1.00
R5667:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5671:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5918:Lmbr1l UTSW 15 98912427 missense probably damaging 0.99
R6735:Lmbr1l UTSW 15 98909240 missense probably damaging 1.00
R6882:Lmbr1l UTSW 15 98907586 missense probably damaging 0.99
R7131:Lmbr1l UTSW 15 98906323 missense probably benign 0.05
R7136:Lmbr1l UTSW 15 98911491 splice site probably null
R7169:Lmbr1l UTSW 15 98909158 frame shift probably null
R7169:Lmbr1l UTSW 15 98909194 critical splice donor site probably benign
R7336:Lmbr1l UTSW 15 98913587 missense possibly damaging 0.94
R7541:Lmbr1l UTSW 15 98909386 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTACCAAGGTCCCACTTACTC -3'
(R):5'- GCTCTGACTCGAAGAATCTGC -3'

Sequencing Primer
(F):5'- GCATGTGAACCCACCGTCAG -3'
(R):5'- TGCAGTGAGTCTAAATCCGC -3'
Posted On2019-10-24