Mutagenetix > Incidental Mutations

Incidental Mutation 'R7603:Urb1'

588136

Institutional Source

Beutler Lab

Gene Symbol

Urb1

Ensembl Gene

ENSMUSG00000039929

Gene Name

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms

4921511H13Rik, 5730405K23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7603 (G1)

Quality Score

217.468

Status

Validated

Chromosome

Chromosomal Location

90751527-90810413 bp(-) (GRCm38)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

CACTTAC to CAC at 90772573 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140920]

Predicted Effect

probably benign
Transcript: ENSMUST00000140920

SMART Domains

Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:Npa1	78	396	1.5e-86	PFAM
low complexity region	751	761	N/A	INTRINSIC
low complexity region	955	966	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
low complexity region	1360	1375	N/A	INTRINSIC
Pfam:NopRA1	1670	1859	3.6e-60	PFAM
low complexity region	2029	2040	N/A	INTRINSIC
low complexity region	2092	2111	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (47/48)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,566,191	T709A	probably benign	Het
Abca6	T	C	11: 110,180,258	K1536E	possibly damaging	Het
Abhd16a	T	A	17: 35,101,960		probably null	Het
Actrt3	C	T	3: 30,598,547	A133T	probably benign	Het
Adcy10	C	T	1: 165,564,237	R1329W	probably damaging	Het
Apol7b	T	C	15: 77,423,456	M280V	possibly damaging	Het
Canx	A	T	11: 50,311,628	D50E	probably benign	Het
Csmd1	A	T	8: 16,288,682	D470E	probably damaging	Het
Cyp2c23	C	T	19: 44,014,930	D269N	probably damaging	Het
Ddah1	T	C	3: 145,759,019	V53A	probably benign	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Fastkd5	A	G	2: 130,615,041	V543A	possibly damaging	Het
Fggy	G	A	4: 95,769,506	G295R	probably damaging	Het
Frs2	T	C	10: 117,074,063	T465A	probably benign	Het
Glipr1	A	T	10: 111,988,832	N156K	probably benign	Het
Gnpnat1	C	T	14: 45,384,617	V40I	probably benign	Het
H2-Q7	T	C	17: 35,439,963	L130P	probably damaging	Het
Herc1	T	A	9: 66,451,383	L86*	probably null	Het
Hspg2	T	C	4: 137,548,368	L2778P	probably damaging	Het
Hspg2	T	A	4: 137,557,192	I3487N	possibly damaging	Het
Htra4	T	G	8: 25,025,700	I441L	probably benign	Het
Ints7	A	T	1: 191,596,224	H203L	probably damaging	Het
Lama2	T	C	10: 27,266,680	T601A	possibly damaging	Het
Lin7b	T	C	7: 45,368,432		probably benign	Het
Lmbr1l	G	A	15: 98,908,691	Q280*	probably null	Het
Lpin3	G	T	2: 160,903,754		probably null	Het
Map1lc3b	A	T	8: 121,593,529	H27L	possibly damaging	Het
Mfsd14a	C	A	3: 116,633,883	V369F	probably damaging	Het
Ndufa12	C	T	10: 94,220,779	A123V	probably benign	Het
Nek9	A	G	12: 85,303,514	F929L	probably benign	Het
Nup210	A	T	6: 91,076,697	D279E	probably benign	Het
Olfr553	A	G	7: 102,614,938	V17A	probably benign	Het
Parp1	T	C	1: 180,600,212		probably null	Het
Phc3	T	C	3: 30,907,452	I944V	probably damaging	Het
Phf20	C	T	2: 156,302,851	A793V	probably benign	Het
Phf21a	A	C	2: 92,357,007	R540S	probably benign	Het
Pogk	A	G	1: 166,401,911	C124R	probably benign	Het
Rif1	C	T	2: 52,076,175	S93L	probably damaging	Het
Sele	A	G	1: 164,049,515	E120G	probably damaging	Het
Slc4a1ap	T	C	5: 31,546,195	L49P		Het
Snap47	T	C	11: 59,428,547	D255G	probably damaging	Het
Tcstv3	T	C	13: 120,317,610	V15A	probably damaging	Het
Tmcc1	A	T	6: 116,043,131	Y453*	probably null	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Usp20	T	A	2: 31,011,474	V459E	probably damaging	Het
Vmn1r202	A	T	13: 22,501,620	L209Q	probably damaging	Het
Vps13b	T	C	15: 35,576,439	S998P	probably damaging	Het

Other mutations in Urb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Urb1	APN	16	90753321	critical splice donor site	probably null
IGL00915:Urb1	APN	16	90779098	missense	possibly damaging	0.76
IGL01108:Urb1	APN	16	90792814	missense	probably damaging	1.00
IGL01122:Urb1	APN	16	90804458	missense	possibly damaging	0.81
IGL01387:Urb1	APN	16	90757761	missense	possibly damaging	0.64
IGL01484:Urb1	APN	16	90777560	missense	probably benign	0.11
IGL01606:Urb1	APN	16	90760459	missense	probably damaging	1.00
IGL01989:Urb1	APN	16	90769586	splice site	probably benign
IGL02516:Urb1	APN	16	90772695	missense	possibly damaging	0.49
IGL03018:Urb1	APN	16	90788156	missense	probably benign	0.02
IGL03165:Urb1	APN	16	90780304	missense	probably damaging	1.00
IGL03216:Urb1	APN	16	90788114	missense	probably benign	0.00
H8562:Urb1	UTSW	16	90769469	missense	probably benign	0.08
H8786:Urb1	UTSW	16	90769469	missense	probably benign	0.08
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0359:Urb1	UTSW	16	90791160	missense	probably damaging	1.00
R0386:Urb1	UTSW	16	90796399	missense	probably damaging	1.00
R0508:Urb1	UTSW	16	90783262	splice site	probably benign
R0517:Urb1	UTSW	16	90777422	nonsense	probably null
R0704:Urb1	UTSW	16	90776207	missense	probably benign	0.31
R0755:Urb1	UTSW	16	90774094	missense	probably damaging	1.00
R0755:Urb1	UTSW	16	90779138	missense	probably benign
R0783:Urb1	UTSW	16	90810297	missense	possibly damaging	0.55
R0833:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0836:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0970:Urb1	UTSW	16	90769447	missense	possibly damaging	0.83
R1144:Urb1	UTSW	16	90776318	splice site	probably null
R1344:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1418:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1453:Urb1	UTSW	16	90796492	missense	probably damaging	1.00
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1520:Urb1	UTSW	16	90774745	missense	probably benign	0.00
R1521:Urb1	UTSW	16	90753863	missense	probably damaging	1.00
R1598:Urb1	UTSW	16	90777440	missense	possibly damaging	0.93
R1617:Urb1	UTSW	16	90760452	missense	possibly damaging	0.82
R1625:Urb1	UTSW	16	90774048	critical splice donor site	probably null
R1640:Urb1	UTSW	16	90772626	missense	probably benign	0.00
R1664:Urb1	UTSW	16	90788082	critical splice donor site	probably null
R1672:Urb1	UTSW	16	90787397	missense	probably damaging	1.00
R1694:Urb1	UTSW	16	90767040	missense	probably benign
R1856:Urb1	UTSW	16	90761695	missense	probably benign	0.00
R2001:Urb1	UTSW	16	90762344	missense	probably benign	0.30
R2196:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R2850:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R3009:Urb1	UTSW	16	90774798	missense	probably benign	0.09
R3104:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3105:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3106:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3160:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3162:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3900:Urb1	UTSW	16	90783376	missense	possibly damaging	0.86
R4014:Urb1	UTSW	16	90769465	missense	probably damaging	1.00
R4036:Urb1	UTSW	16	90788086	missense	probably benign
R4332:Urb1	UTSW	16	90774537	missense	probably damaging	1.00
R4448:Urb1	UTSW	16	90769394	missense	possibly damaging	0.71
R4581:Urb1	UTSW	16	90788146	missense	probably benign	0.04
R4593:Urb1	UTSW	16	90787444	missense	probably damaging	1.00
R4610:Urb1	UTSW	16	90776271	missense	probably benign	0.43
R4659:Urb1	UTSW	16	90776129	missense	probably damaging	0.96
R4672:Urb1	UTSW	16	90772634	missense	probably benign
R4681:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R4771:Urb1	UTSW	16	90753518	missense	probably benign	0.00
R4790:Urb1	UTSW	16	90769555	nonsense	probably null
R4798:Urb1	UTSW	16	90757827	missense	probably benign	0.12
R4809:Urb1	UTSW	16	90759842	missense	possibly damaging	0.82
R4850:Urb1	UTSW	16	90795414	nonsense	probably null
R4916:Urb1	UTSW	16	90783328	missense	probably damaging	1.00
R4969:Urb1	UTSW	16	90805411	missense	probably damaging	1.00
R5032:Urb1	UTSW	16	90756171	missense	probably benign	0.00
R5111:Urb1	UTSW	16	90752017	missense	probably benign	0.00
R5122:Urb1	UTSW	16	90752095	nonsense	probably null
R5184:Urb1	UTSW	16	90783274	critical splice donor site	probably null
R5199:Urb1	UTSW	16	90792748	missense	possibly damaging	0.95
R5436:Urb1	UTSW	16	90792762	missense	probably damaging	1.00
R5767:Urb1	UTSW	16	90776163	missense	probably benign	0.00
R5812:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R5872:Urb1	UTSW	16	90772764	nonsense	probably null
R6052:Urb1	UTSW	16	90762383	missense	probably damaging	1.00
R6063:Urb1	UTSW	16	90789097	missense	probably benign	0.02
R6065:Urb1	UTSW	16	90803332	missense	probably benign	0.03
R6181:Urb1	UTSW	16	90779094	missense	probably benign	0.00
R6268:Urb1	UTSW	16	90753919	missense	probably benign	0.03
R6429:Urb1	UTSW	16	90762430	splice site	probably null
R6572:Urb1	UTSW	16	90787414	missense	probably benign	0.37
R6606:Urb1	UTSW	16	90810268	missense	probably benign	0.00
R6730:Urb1	UTSW	16	90779083	missense	possibly damaging	0.89
R6838:Urb1	UTSW	16	90782106	missense	possibly damaging	0.93
R7237:Urb1	UTSW	16	90791166	missense	probably damaging	1.00
R7238:Urb1	UTSW	16	90752115	missense	possibly damaging	0.88
R7339:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7341:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7361:Urb1	UTSW	16	90774768	missense	probably damaging	0.99
R7365:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7366:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7440:Urb1	UTSW	16	90787408	missense	probably damaging	1.00
R7530:Urb1	UTSW	16	90761634	missense	probably damaging	1.00
R7553:Urb1	UTSW	16	90792864	missense	probably damaging	1.00
R7557:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7607:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7609:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7610:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7612:Urb1	UTSW	16	90797910	missense	probably damaging	1.00
R7613:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7684:Urb1	UTSW	16	90786118	nonsense	probably null
R8029:Urb1	UTSW	16	90779152	missense	possibly damaging	0.67
R8324:Urb1	UTSW	16	90791190	missense	probably damaging	1.00
R8680:Urb1	UTSW	16	90774625	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90753883	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90774862	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CCTGAACACTGTTGATCTGTGG -3'
(R):5'- CAGTGTTGTGATCTGCTACCC -3'

Sequencing Primer
(F):5'- ATCTGTGGGTGGCTTTCCATG -3'
(R):5'- TTGGACCCTGGCTGACTCTG -3'

Posted On

2019-10-24