Incidental Mutation 'R7603:H2-Q7'
ID588138
Institutional Source Beutler Lab
Gene Symbol H2-Q7
Ensembl Gene ENSMUSG00000060550
Gene Namehistocompatibility 2, Q region locus 7
SynonymsPed, Qa7, Qa-7, H-2Q7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R7603 (G1)
Quality Score136.008
Status Not validated
Chromosome17
Chromosomal Location35439155-35443773 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35439963 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 130 (L130P)
Ref Sequence ENSEMBL: ENSMUSP00000071843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071951] [ENSMUST00000076256] [ENSMUST00000078205] [ENSMUST00000116598]
PDB Structure
crystal structure of the non-classical MHC class Ib Qa-2 complexed with a self peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000071951
AA Change: L130P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071843
Gene: ENSMUSG00000060550
AA Change: L130P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 3e-97 PFAM
IGc1 219 290 7.68e-23 SMART
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076256
AA Change: L130P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075606
Gene: ENSMUSG00000060550
AA Change: L130P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 3.3e-98 PFAM
IGc1 219 290 7.68e-23 SMART
low complexity region 310 325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078205
AA Change: L130P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077335
Gene: ENSMUSG00000060550
AA Change: L130P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.9e-97 PFAM
IGc1 219 290 7.68e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116598
AA Change: L130P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112297
Gene: ENSMUSG00000060550
AA Change: L130P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 8.5e-98 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls a widely distributed lymphocyte antigen recognized by monoclonal antibody, serology or CTL assay. Using all assays, antigen is present (allele a) in C57BL/6, DBA/1, DBA/2 and SWR and absent (allele b) in AKR, C3H and BALB/c. Other strain allele typings were assay-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in H2-Q7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0735:H2-Q7 UTSW 17 35440186 critical splice donor site probably null
R0839:H2-Q7 UTSW 17 35439712 missense probably damaging 1.00
R1737:H2-Q7 UTSW 17 35439626 missense probably damaging 1.00
R1831:H2-Q7 UTSW 17 35439699 missense probably benign 0.00
R1832:H2-Q7 UTSW 17 35439699 missense probably benign 0.00
R1833:H2-Q7 UTSW 17 35439699 missense probably benign 0.00
R2047:H2-Q7 UTSW 17 35440147 missense probably damaging 1.00
R4498:H2-Q7 UTSW 17 35439530 missense probably damaging 1.00
R4657:H2-Q7 UTSW 17 35442759 missense possibly damaging 0.86
R4784:H2-Q7 UTSW 17 35439938 missense probably damaging 1.00
R5387:H2-Q7 UTSW 17 35439542 missense probably damaging 1.00
R5499:H2-Q7 UTSW 17 35439940 nonsense probably null
R6410:H2-Q7 UTSW 17 35440176 missense probably benign 0.13
R6457:H2-Q7 UTSW 17 35439679 missense probably damaging 1.00
R6720:H2-Q7 UTSW 17 35442678 missense probably benign 0.05
R6943:H2-Q7 UTSW 17 35439584 missense probably benign 0.30
R7069:H2-Q7 UTSW 17 35440031 missense probably damaging 0.98
R7086:H2-Q7 UTSW 17 35439485 missense probably damaging 1.00
R7303:H2-Q7 UTSW 17 35440061 missense probably benign 0.13
R7520:H2-Q7 UTSW 17 35442710 missense probably benign 0.04
R7747:H2-Q7 UTSW 17 35440061 missense probably benign 0.13
Z1177:H2-Q7 UTSW 17 35439162 start gained probably benign
Z1177:H2-Q7 UTSW 17 35442500 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGTCCGAGTTTCAGGAGCAG -3'
(R):5'- TCTTCTTCCCCAGGACTGAG -3'

Sequencing Primer
(F):5'- GTTTCAGGAGCAGAACTGACCC -3'
(R):5'- TTCCCGAGCTGCAGGTATCTG -3'
Posted On2019-10-24