Mutagenetix > Incidental Mutation

Incidental Mutation 'R7604:Malrd1'

588141

Institutional Source

Beutler Lab

Gene Symbol

Malrd1

Ensembl Gene

ENSMUSG00000075520

Gene Name

MAM and LDL receptor class A domain containing 1

Synonyms

Diet1, Gm13364, Gm13318

MMRRC Submission

045644-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R7604 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15526479-16255555 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15925192 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1503 (N1503S)

Ref Sequence

ENSEMBL: ENSMUSP00000116869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146205]

AlphaFold

A2AJX4

Predicted Effect

unknown
Transcript: ENSMUST00000146205
AA Change: N1503S

SMART Domains

Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: N1503S

Domain	Start	End	E-Value	Type
Pfam:MAM	8	171	1.6e-36	PFAM
LDLa	181	219	6.89e-8	SMART
LDLa	225	262	4.37e-10	SMART
LDLa	264	303	9.55e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (73/73)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	T	3: 146,650,660	Y164*	probably null	Het
4932438A13Rik	A	G	3: 36,949,843		probably null	Het
9130019O22Rik	T	C	7: 127,386,535	T95A	unknown	Het
Abce1	G	A	8: 79,699,374	T258M	probably benign	Het
Actl7b	G	C	4: 56,740,693	P222A	probably benign	Het
Adam2	T	C	14: 66,056,541	N279S	probably benign	Het
Adamts13	A	G	2: 27,005,206	D1103G	probably benign	Het
Aff1	G	A	5: 103,847,809	S1089N	probably benign	Het
Ahcyl2	T	C	6: 29,768,556	S7P	unknown	Het
Anks1b	A	G	10: 90,260,846		probably null	Het
Azin1	A	C	15: 38,491,634	D359E	probably damaging	Het
Bahd1	A	G	2: 118,916,310	T137A	probably benign	Het
C1qbp	A	G	11: 70,978,772	S162P	probably damaging	Het
C1rb	A	G	6: 124,580,484	M527V	not run	Het
Ccdc88c	A	T	12: 100,930,547	D1381E	probably damaging	Het
Ccdc90b	A	G	7: 92,578,530	Y234C	probably damaging	Het
Cyp11b2	A	T	15: 74,853,750		probably null	Het
Dchs1	A	G	7: 105,765,982	V665A	probably damaging	Het
Dhx8	T	C	11: 101,764,797	S1119P	probably damaging	Het
Dnah6	T	C	6: 73,092,168	D2512G	probably damaging	Het
Dnah8	T	C	17: 30,813,095	Y4130H	probably damaging	Het
E4f1	G	T	17: 24,455,233	A19D	unknown	Het
Eftud2	T	C	11: 102,848,012	D517G	possibly damaging	Het
Epha6	T	A	16: 60,205,772	I436F	possibly damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ezh1	A	G	11: 101,217,029	M74T	probably benign	Het
Fam71d	C	A	12: 78,715,014	Q151K	probably damaging	Het
Galnt14	T	A	17: 73,504,921	K435M	possibly damaging	Het
Gde1	A	T	7: 118,705,536	Y39N	possibly damaging	Het
Gldn	G	A	9: 54,338,593	R476Q	probably benign	Het
Gm32742	G	T	9: 51,156,762	R307S	probably benign	Het
Gnao1	T	G	8: 93,944,344	N150K		Het
Gpr135	A	T	12: 72,069,867	D375E	possibly damaging	Het
Gria4	A	G	9: 4,464,315	M549T	probably damaging	Het
Grik3	C	A	4: 125,623,635	D90E	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Hspd1	T	C	1: 55,080,337	E327G	probably benign	Het
Kif6	T	C	17: 49,671,101	I107T	probably damaging	Het
Kmt2e	C	T	5: 23,501,765	T1442M	not run	Het
Lama3	C	T	18: 12,500,493	H1561Y	possibly damaging	Het
Lpcat3	A	G	6: 124,702,530	N331S	probably benign	Het
Lrrc63	C	A	14: 75,084,969	W565L	possibly damaging	Het
Maats1	C	A	16: 38,298,236	E734*	probably null	Het
Mcm7	C	T	5: 138,169,724	V38I	probably benign	Het
Mphosph9	C	T	5: 124,316,117	V106I	probably benign	Het
Mroh8	G	T	2: 157,269,564	L157I	possibly damaging	Het
Mta2	T	A	19: 8,945,836	S91T	probably damaging	Het
Muc5ac	A	T	7: 141,809,709	Q2252H	unknown	Het
Ndufs7	G	T	10: 80,253,697	V59L	probably benign	Het
Nrxn2	T	C	19: 6,531,961	L1642P	probably damaging	Het
Olfr1053	G	A	2: 86,314,900	P129S	probably damaging	Het
Pbxip1	A	T	3: 89,445,595	I183L	probably benign	Het
Peak1	A	T	9: 56,241,207	L1085*	probably null	Het
Phf20l1	A	G	15: 66,604,084	T189A	probably benign	Het
Poteg	T	A	8: 27,458,655		probably null	Het
Proc	G	A	18: 32,134,778		probably null	Het
Prr36	G	A	8: 4,214,836	R277C	unknown	Het
Ptpn3	T	C	4: 57,240,845	N257D	probably damaging	Het
Rnf5	C	A	17: 34,601,664	V150L	probably benign	Het
Sbf2	T	A	7: 110,378,067	Q666L	possibly damaging	Het
Sdk2	C	T	11: 113,829,969	R1378H	possibly damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sipa1l2	A	T	8: 125,419,272	V1681E	probably benign	Het
Slc15a5	A	T	6: 138,079,786	L44Q	probably damaging	Het
Slc29a1	C	A	17: 45,592,324		probably null	Het
Slc5a8	G	T	10: 88,904,960	V246F	possibly damaging	Het
Spint2	T	C	7: 29,258,519	E154G	probably damaging	Het
Sycp1	A	T	3: 102,913,433	S413T	probably damaging	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Trio	A	T	15: 27,736,445		probably null	Het
Unc13b	A	G	4: 43,170,102	Y310C	unknown	Het
Unc13b	A	G	4: 43,256,776	T1155A	possibly damaging	Het
Vmn2r79	A	G	7: 87,003,384		probably null	Het
Xpo7	T	A	14: 70,671,670	S803C	probably damaging	Het

Other mutations in Malrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Malrd1	APN	2	16142186	splice site	probably benign
IGL01295:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01296:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01399:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01400:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01401:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01402:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01405:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01406:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL02105:Malrd1	APN	2	16127863	missense	unknown
IGL02581:Malrd1	APN	2	16142312	nonsense	probably null
IGL03015:Malrd1	APN	2	16042271	missense	unknown
IGL03038:Malrd1	APN	2	16127967	missense	unknown
R1353:Malrd1	UTSW	2	16127968	missense	unknown
R1385:Malrd1	UTSW	2	16042228	missense	unknown
R2242:Malrd1	UTSW	2	16101944	missense	unknown
R2888:Malrd1	UTSW	2	16074757	missense	unknown
R4398:Malrd1	UTSW	2	16150783	missense	unknown
R4982:Malrd1	UTSW	2	16042129	missense	probably benign	0.29
R5148:Malrd1	UTSW	2	16142226	missense	unknown
R5195:Malrd1	UTSW	2	16150810	missense	unknown
R5828:Malrd1	UTSW	2	15526653	missense	probably benign	0.00
R5892:Malrd1	UTSW	2	15614267	missense	probably benign	0.03
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6195:Malrd1	UTSW	2	15695326	missense	probably damaging	1.00
R6318:Malrd1	UTSW	2	16042267	missense	unknown
R6438:Malrd1	UTSW	2	15614206	missense
R6457:Malrd1	UTSW	2	15526597	start gained	probably benign
R6457:Malrd1	UTSW	2	15667929	missense	probably benign	0.41
R6499:Malrd1	UTSW	2	15931689	missense	probably benign	0.03
R6575:Malrd1	UTSW	2	15842628	missense	probably benign	0.00
R6792:Malrd1	UTSW	2	16150756	missense	unknown
R6796:Malrd1	UTSW	2	15869784	missense	unknown
R6930:Malrd1	UTSW	2	15797667	missense	unknown
R6959:Malrd1	UTSW	2	16218009	missense	probably damaging	0.97
R6993:Malrd1	UTSW	2	16150791	missense	unknown
R7102:Malrd1	UTSW	2	16142303	missense	unknown
R7112:Malrd1	UTSW	2	15925176	missense	unknown
R7248:Malrd1	UTSW	2	16101911	missense	unknown
R7249:Malrd1	UTSW	2	15623340	missense	probably damaging	0.97
R7334:Malrd1	UTSW	2	16006718	missense	probably damaging	0.99
R7394:Malrd1	UTSW	2	15695199	missense	unknown
R7399:Malrd1	UTSW	2	15610090	missense
R7476:Malrd1	UTSW	2	16142304	missense	unknown
R7582:Malrd1	UTSW	2	15695270	missense	unknown
R7662:Malrd1	UTSW	2	15871454	missense	unknown
R7681:Malrd1	UTSW	2	16218102	missense	unknown
R7740:Malrd1	UTSW	2	15614215	missense	not run
R7747:Malrd1	UTSW	2	16074835	missense	unknown
R7754:Malrd1	UTSW	2	15797799	splice site	probably null
R7950:Malrd1	UTSW	2	16128068	missense	unknown
R8194:Malrd1	UTSW	2	15925120	missense	unknown
R8260:Malrd1	UTSW	2	15614206	missense
R8314:Malrd1	UTSW	2	15752832	missense	unknown
R8342:Malrd1	UTSW	2	15633224	missense	unknown
R8386:Malrd1	UTSW	2	15696844	missense	unknown
R8492:Malrd1	UTSW	2	15610123	missense
R8728:Malrd1	UTSW	2	15696942	nonsense	probably null
R8756:Malrd1	UTSW	2	15752895	critical splice donor site	probably null
R8869:Malrd1	UTSW	2	15565557	critical splice donor site	probably null
R8888:Malrd1	UTSW	2	15845227	missense	unknown
R8895:Malrd1	UTSW	2	15845227	missense	unknown
R8902:Malrd1	UTSW	2	16255334	nonsense	probably null
R8954:Malrd1	UTSW	2	15551367	missense
R8960:Malrd1	UTSW	2	15565430	nonsense	probably null
R9005:Malrd1	UTSW	2	15845329	missense	unknown
R9135:Malrd1	UTSW	2	15797705	missense	unknown
R9267:Malrd1	UTSW	2	16255266	missense	unknown
R9330:Malrd1	UTSW	2	16255278	missense	unknown
R9359:Malrd1	UTSW	2	15614177	missense
R9383:Malrd1	UTSW	2	15695201	missense	unknown
R9389:Malrd1	UTSW	2	15703156	missense	unknown
R9403:Malrd1	UTSW	2	15614177	missense
R9454:Malrd1	UTSW	2	15752849	missense	unknown
R9454:Malrd1	UTSW	2	15797726	nonsense	probably null
R9520:Malrd1	UTSW	2	16074820	missense	unknown
R9544:Malrd1	UTSW	2	15635998	missense	unknown
R9609:Malrd1	UTSW	2	15695270	missense	unknown
R9667:Malrd1	UTSW	2	15565215	critical splice acceptor site	probably null
R9721:Malrd1	UTSW	2	15696827	missense	unknown
R9787:Malrd1	UTSW	2	15620590	missense	unknown
R9800:Malrd1	UTSW	2	15842594	missense	unknown
Z1176:Malrd1	UTSW	2	16217845	missense	unknown
Z1191:Malrd1	UTSW	2	16042226	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGAATAACCATGCATTCCATTTGTG -3'
(R):5'- GGGTGGCTACAAACAACAGC -3'

Sequencing Primer
(F):5'- GCATTCCATTTGTGTTTCATTCCAGG -3'
(R):5'- GTGGCTACAAACAACAGCATCAAC -3'

Posted On

2019-10-24