Mutagenetix > Incidental Mutations

Incidental Mutation 'R7604:Adamts13'

588142

Institutional Source

Beutler Lab

Gene Symbol

Adamts13

Ensembl Gene

ENSMUSG00000014852

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13

Synonyms

vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R7604 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26973416-27009628 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27005206 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1103 (D1103G)

Ref Sequence

ENSEMBL: ENSMUSP00000099955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102891] [ENSMUST00000114004] [ENSMUST00000114005] [ENSMUST00000114006] [ENSMUST00000114007]

Predicted Effect

probably benign
Transcript: ENSMUST00000102891
AA Change: D1103G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: D1103G

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	8.5e-11	PFAM
Pfam:Reprolysin	96	291	4.9e-14	PFAM
Pfam:Reprolysin_3	106	237	5.6e-11	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART
Blast:TSP1	1022	1079	4e-26	BLAST
TSP1	1081	1137	4.58e-4	SMART
Blast:CUB	1196	1293	2e-39	BLAST
Blast:CUB	1303	1412	3e-63	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000114004

SMART Domains

Protein: ENSMUSP00000109637
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Cg6151-P	33	106	7.88e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114005

SMART Domains

Protein: ENSMUSP00000109638
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Cg6151-P	33	114	5.53e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114006

SMART Domains

Protein: ENSMUSP00000109639
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Cg6151-P	33	142	2.87e-61	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114007

SMART Domains

Protein: ENSMUSP00000109640
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Cg6151-P	33	142	2.87e-61	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133807

SMART Domains

Protein: ENSMUSP00000122562
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	29	42	N/A	INTRINSIC
Cg6151-P	53	118	8.02e-10	SMART

Meta Mutation Damage Score

0.1407

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	T	3: 146,650,660	Y164*	probably null	Het
4932438A13Rik	A	G	3: 36,949,843		probably null	Het
9130019O22Rik	T	C	7: 127,386,535	T95A	unknown	Het
Abce1	G	A	8: 79,699,374	T258M	probably benign	Het
Actl7b	G	C	4: 56,740,693	P222A	probably benign	Het
Adam2	T	C	14: 66,056,541	N279S	probably benign	Het
Aff1	G	A	5: 103,847,809	S1089N	probably benign	Het
Ahcyl2	T	C	6: 29,768,556	S7P	unknown	Het
Anks1b	A	G	10: 90,260,846		probably null	Het
Azin1	A	C	15: 38,491,634	D359E	probably damaging	Het
Bahd1	A	G	2: 118,916,310	T137A	probably benign	Het
C1qbp	A	G	11: 70,978,772	S162P	probably damaging	Het
C1rb	A	G	6: 124,580,484	M527V	not run	Het
Ccdc88c	A	T	12: 100,930,547	D1381E	probably damaging	Het
Ccdc90b	A	G	7: 92,578,530	Y234C	probably damaging	Het
Cyp11b2	A	T	15: 74,853,750		probably null	Het
Dchs1	A	G	7: 105,765,982	V665A	probably damaging	Het
Dhx8	T	C	11: 101,764,797	S1119P	probably damaging	Het
Dnah6	T	C	6: 73,092,168	D2512G	probably damaging	Het
Dnah8	T	C	17: 30,813,095	Y4130H	probably damaging	Het
E4f1	G	T	17: 24,455,233	A19D	unknown	Het
Eftud2	T	C	11: 102,848,012	D517G	possibly damaging	Het
Epha6	T	A	16: 60,205,772	I436F	possibly damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ezh1	A	G	11: 101,217,029	M74T	probably benign	Het
Fam71d	C	A	12: 78,715,014	Q151K	probably damaging	Het
Galnt14	T	A	17: 73,504,921	K435M	possibly damaging	Het
Gde1	A	T	7: 118,705,536	Y39N	possibly damaging	Het
Gldn	G	A	9: 54,338,593	R476Q	probably benign	Het
Gm32742	G	T	9: 51,156,762	R307S	probably benign	Het
Gnao1	T	G	8: 93,944,344	N150K		Het
Gpr135	A	T	12: 72,069,867	D375E	possibly damaging	Het
Gria4	A	G	9: 4,464,315	M549T	probably damaging	Het
Grik3	C	A	4: 125,623,635	D90E	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911		probably null	Het
Hspd1	T	C	1: 55,080,337	E327G	probably benign	Het
Kif6	T	C	17: 49,671,101	I107T	probably damaging	Het
Kmt2e	C	T	5: 23,501,765	T1442M	not run	Het
Lama3	C	T	18: 12,500,493	H1561Y	possibly damaging	Het
Lpcat3	A	G	6: 124,702,530	N331S	probably benign	Het
Lrrc63	C	A	14: 75,084,969	W565L	possibly damaging	Het
Maats1	C	A	16: 38,298,236	E734*	probably null	Het
Malrd1	A	G	2: 15,925,192	N1503S	unknown	Het
Mcm7	C	T	5: 138,169,724	V38I	probably benign	Het
Mphosph9	C	T	5: 124,316,117	V106I	probably benign	Het
Mroh8	G	T	2: 157,269,564	L157I	possibly damaging	Het
Mta2	T	A	19: 8,945,836	S91T	probably damaging	Het
Muc5ac	A	T	7: 141,809,709	Q2252H	unknown	Het
Ndufs7	G	T	10: 80,253,697	V59L	probably benign	Het
Nrxn2	T	C	19: 6,531,961	L1642P	probably damaging	Het
Olfr1053	G	A	2: 86,314,900	P129S	probably damaging	Het
Pbxip1	A	T	3: 89,445,595	I183L	probably benign	Het
Peak1	A	T	9: 56,241,207	L1085*	probably null	Het
Phf20l1	A	G	15: 66,604,084	T189A	probably benign	Het
Poteg	T	A	8: 27,458,655		probably null	Het
Proc	G	A	18: 32,134,778		probably null	Het
Prr36	G	A	8: 4,214,836	R277C	unknown	Het
Ptpn3	T	C	4: 57,240,845	N257D	probably damaging	Het
Rnf5	C	A	17: 34,601,664	V150L	probably benign	Het
Sbf2	T	A	7: 110,378,067	Q666L	possibly damaging	Het
Sdk2	C	T	11: 113,829,969	R1378H	possibly damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sipa1l2	A	T	8: 125,419,272	V1681E	probably benign	Het
Slc15a5	A	T	6: 138,079,786	L44Q	probably damaging	Het
Slc29a1	C	A	17: 45,592,324		probably null	Het
Slc5a8	G	T	10: 88,904,960	V246F	possibly damaging	Het
Spint2	T	C	7: 29,258,519	E154G	probably damaging	Het
Sycp1	A	T	3: 102,913,433	S413T	probably damaging	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Trio	A	T	15: 27,736,445		probably null	Het
Unc13b	A	G	4: 43,256,776	T1155A	possibly damaging	Het
Unc13b	A	G	4: 43,170,102	Y310C	unknown	Het
Vmn2r79	A	G	7: 87,003,384		probably null	Het
Xpo7	T	A	14: 70,671,670	S803C	probably damaging	Het

Other mutations in Adamts13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adamts13	APN	2	27005361	missense	probably benign	0.04
IGL00465:Adamts13	APN	2	26973555	missense	probably benign	0.32
IGL01114:Adamts13	APN	2	27005190	missense	probably benign	0.41
IGL01138:Adamts13	APN	2	26983042	missense	probably damaging	1.00
IGL01154:Adamts13	APN	2	27006194	missense	probably benign
IGL01860:Adamts13	APN	2	26978011	missense	probably damaging	0.99
IGL01924:Adamts13	APN	2	26996583	missense	possibly damaging	0.80
IGL01991:Adamts13	APN	2	26990598	missense	probably damaging	0.97
IGL02215:Adamts13	APN	2	26985483	missense	probably damaging	1.00
IGL02415:Adamts13	APN	2	26989283	missense	possibly damaging	0.95
IGL02519:Adamts13	APN	2	26978675	missense	probably damaging	1.00
IGL02956:Adamts13	APN	2	26983037	missense	probably benign	0.18
IGL03209:Adamts13	APN	2	26992961	missense	probably benign	0.00
I1329:Adamts13	UTSW	2	26973619	missense	possibly damaging	0.52
IGL02837:Adamts13	UTSW	2	26991420	missense	probably benign	0.01
IGL03048:Adamts13	UTSW	2	26978699	critical splice donor site	probably null
R0041:Adamts13	UTSW	2	26983974	missense	probably damaging	1.00
R0217:Adamts13	UTSW	2	26996921	splice site	probably benign
R0276:Adamts13	UTSW	2	26975760	missense	possibly damaging	0.91
R0309:Adamts13	UTSW	2	26986989	missense	probably damaging	0.99
R0348:Adamts13	UTSW	2	26981080	missense	probably benign	0.13
R0369:Adamts13	UTSW	2	27005186	missense	probably benign	0.00
R0386:Adamts13	UTSW	2	26986679	splice site	probably null
R0553:Adamts13	UTSW	2	26991334	nonsense	probably null
R0714:Adamts13	UTSW	2	26986985	splice site	probably benign
R0862:Adamts13	UTSW	2	27006324	critical splice donor site	probably null
R1320:Adamts13	UTSW	2	26989246	missense	probably damaging	0.97
R1458:Adamts13	UTSW	2	26988354	missense	probably damaging	1.00
R1473:Adamts13	UTSW	2	26981753	nonsense	probably null
R1491:Adamts13	UTSW	2	26978315	missense	probably damaging	1.00
R1588:Adamts13	UTSW	2	26975675	missense	probably benign	0.01
R1638:Adamts13	UTSW	2	26996583	missense	possibly damaging	0.80
R1724:Adamts13	UTSW	2	26991294	missense	probably benign	0.00
R1924:Adamts13	UTSW	2	26984141	missense	probably damaging	1.00
R2001:Adamts13	UTSW	2	26973990	missense	probably benign
R2072:Adamts13	UTSW	2	27005425	missense	probably benign	0.10
R2073:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R2409:Adamts13	UTSW	2	26978362	missense	probably benign	0.00
R4362:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4363:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4422:Adamts13	UTSW	2	27005400	missense	probably benign	0.00
R4769:Adamts13	UTSW	2	27008711	nonsense	probably null
R4785:Adamts13	UTSW	2	26983042	missense	probably damaging	1.00
R4831:Adamts13	UTSW	2	26983130	critical splice donor site	probably null
R4832:Adamts13	UTSW	2	26989402	missense	probably benign	0.22
R4945:Adamts13	UTSW	2	26986610	missense	probably damaging	1.00
R5047:Adamts13	UTSW	2	26996910	missense	probably damaging	0.98
R5126:Adamts13	UTSW	2	26996915	critical splice donor site	probably null
R5161:Adamts13	UTSW	2	26993008	missense	probably benign	0.00
R5394:Adamts13	UTSW	2	26986558	missense	probably benign	0.00
R5557:Adamts13	UTSW	2	26973639	missense	probably benign	0.05
R5660:Adamts13	UTSW	2	26996749	missense	probably benign
R5890:Adamts13	UTSW	2	26986591	missense	probably damaging	0.96
R6168:Adamts13	UTSW	2	27004886	missense	probably benign	0.37
R6536:Adamts13	UTSW	2	26975750	missense	probably damaging	0.99
R6929:Adamts13	UTSW	2	27006263	nonsense	probably null
R7207:Adamts13	UTSW	2	26978695	missense	probably damaging	1.00
R7211:Adamts13	UTSW	2	26989298	missense	probably benign	0.40
R7212:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R7392:Adamts13	UTSW	2	26989324	missense	probably damaging	1.00
R7583:Adamts13	UTSW	2	26973953	missense	probably benign
R7783:Adamts13	UTSW	2	26990585	missense	not run
R7814:Adamts13	UTSW	2	26996549	missense	probably benign
R8076:Adamts13	UTSW	2	26990612	missense	probably benign	0.06
R8245:Adamts13	UTSW	2	26990556	missense	probably damaging	1.00
R8526:Adamts13	UTSW	2	26978000	missense	probably benign
X0027:Adamts13	UTSW	2	26985546	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTATGACCCTGGAAGGAGG -3'
(R):5'- ACCTAACCATGCTCTTCCAGG -3'

Sequencing Primer
(F):5'- GGGAGAGTCTGCAGTTGTGTACTC -3'
(R):5'- CTGGGACCACTGCAGAGAAGC -3'

Posted On

2019-10-24