Incidental Mutation 'R7604:4930503B20Rik'
ID 588148
Institutional Source Beutler Lab
Gene Symbol 4930503B20Rik
Ensembl Gene ENSMUSG00000090202
Gene Name RIKEN cDNA 4930503B20 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7604 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 146645193-146651317 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 146650660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 164 (Y164*)
Ref Sequence ENSEMBL: ENSMUSP00000051453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049703] [ENSMUST00000124931] [ENSMUST00000125965] [ENSMUST00000147113] [ENSMUST00000149825] [ENSMUST00000197989]
AlphaFold Q80ZP0
Predicted Effect probably null
Transcript: ENSMUST00000049703
AA Change: Y164*
SMART Domains Protein: ENSMUSP00000051453
Gene: ENSMUSG00000090202
AA Change: Y164*

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124931
SMART Domains Protein: ENSMUSP00000118464
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125965
SMART Domains Protein: ENSMUSP00000119608
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147113
SMART Domains Protein: ENSMUSP00000118934
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000149825
AA Change: Y164*
SMART Domains Protein: ENSMUSP00000114745
Gene: ENSMUSG00000090202
AA Change: Y164*

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197989
SMART Domains Protein: ENSMUSP00000143496
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 9 75 2.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,949,843 probably null Het
9130019O22Rik T C 7: 127,386,535 T95A unknown Het
Abce1 G A 8: 79,699,374 T258M probably benign Het
Actl7b G C 4: 56,740,693 P222A probably benign Het
Adam2 T C 14: 66,056,541 N279S probably benign Het
Adamts13 A G 2: 27,005,206 D1103G probably benign Het
Aff1 G A 5: 103,847,809 S1089N probably benign Het
Ahcyl2 T C 6: 29,768,556 S7P unknown Het
Anks1b A G 10: 90,260,846 probably null Het
Azin1 A C 15: 38,491,634 D359E probably damaging Het
Bahd1 A G 2: 118,916,310 T137A probably benign Het
C1qbp A G 11: 70,978,772 S162P probably damaging Het
C1rb A G 6: 124,580,484 M527V not run Het
Ccdc88c A T 12: 100,930,547 D1381E probably damaging Het
Ccdc90b A G 7: 92,578,530 Y234C probably damaging Het
Cyp11b2 A T 15: 74,853,750 probably null Het
Dchs1 A G 7: 105,765,982 V665A probably damaging Het
Dhx8 T C 11: 101,764,797 S1119P probably damaging Het
Dnah6 T C 6: 73,092,168 D2512G probably damaging Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
E4f1 G T 17: 24,455,233 A19D unknown Het
Eftud2 T C 11: 102,848,012 D517G possibly damaging Het
Epha6 T A 16: 60,205,772 I436F possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ezh1 A G 11: 101,217,029 M74T probably benign Het
Fam71d C A 12: 78,715,014 Q151K probably damaging Het
Galnt14 T A 17: 73,504,921 K435M possibly damaging Het
Gde1 A T 7: 118,705,536 Y39N possibly damaging Het
Gldn G A 9: 54,338,593 R476Q probably benign Het
Gm32742 G T 9: 51,156,762 R307S probably benign Het
Gnao1 T G 8: 93,944,344 N150K Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gria4 A G 9: 4,464,315 M549T probably damaging Het
Grik3 C A 4: 125,623,635 D90E probably damaging Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Hspd1 T C 1: 55,080,337 E327G probably benign Het
Kif6 T C 17: 49,671,101 I107T probably damaging Het
Kmt2e C T 5: 23,501,765 T1442M not run Het
Lama3 C T 18: 12,500,493 H1561Y possibly damaging Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrrc63 C A 14: 75,084,969 W565L possibly damaging Het
Maats1 C A 16: 38,298,236 E734* probably null Het
Malrd1 A G 2: 15,925,192 N1503S unknown Het
Mcm7 C T 5: 138,169,724 V38I probably benign Het
Mphosph9 C T 5: 124,316,117 V106I probably benign Het
Mroh8 G T 2: 157,269,564 L157I possibly damaging Het
Mta2 T A 19: 8,945,836 S91T probably damaging Het
Muc5ac A T 7: 141,809,709 Q2252H unknown Het
Ndufs7 G T 10: 80,253,697 V59L probably benign Het
Nrxn2 T C 19: 6,531,961 L1642P probably damaging Het
Olfr1053 G A 2: 86,314,900 P129S probably damaging Het
Pbxip1 A T 3: 89,445,595 I183L probably benign Het
Peak1 A T 9: 56,241,207 L1085* probably null Het
Phf20l1 A G 15: 66,604,084 T189A probably benign Het
Poteg T A 8: 27,458,655 probably null Het
Proc G A 18: 32,134,778 probably null Het
Prr36 G A 8: 4,214,836 R277C unknown Het
Ptpn3 T C 4: 57,240,845 N257D probably damaging Het
Rnf5 C A 17: 34,601,664 V150L probably benign Het
Sbf2 T A 7: 110,378,067 Q666L possibly damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sipa1l2 A T 8: 125,419,272 V1681E probably benign Het
Slc15a5 A T 6: 138,079,786 L44Q probably damaging Het
Slc29a1 C A 17: 45,592,324 probably null Het
Slc5a8 G T 10: 88,904,960 V246F possibly damaging Het
Spint2 T C 7: 29,258,519 E154G probably damaging Het
Sycp1 A T 3: 102,913,433 S413T probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A T 15: 27,736,445 probably null Het
Unc13b A G 4: 43,256,776 T1155A possibly damaging Het
Unc13b A G 4: 43,170,102 Y310C unknown Het
Vmn2r79 A G 7: 87,003,384 probably null Het
Xpo7 T A 14: 70,671,670 S803C probably damaging Het
Other mutations in 4930503B20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:4930503B20Rik UTSW 3 146650496 missense probably benign
R1131:4930503B20Rik UTSW 3 146651082 missense probably damaging 1.00
R1523:4930503B20Rik UTSW 3 146651109 missense probably damaging 1.00
R2281:4930503B20Rik UTSW 3 146646424 missense probably damaging 0.99
R2520:4930503B20Rik UTSW 3 146650506 missense probably damaging 0.99
R3896:4930503B20Rik UTSW 3 146651113 missense possibly damaging 0.88
R4300:4930503B20Rik UTSW 3 146650920 nonsense probably null
R5196:4930503B20Rik UTSW 3 146646263 utr 3 prime probably benign
R5394:4930503B20Rik UTSW 3 146650608 missense probably damaging 1.00
R5394:4930503B20Rik UTSW 3 146650958 missense probably damaging 1.00
R5645:4930503B20Rik UTSW 3 146650509 missense probably damaging 0.98
R5894:4930503B20Rik UTSW 3 146650925 missense probably benign 0.40
R6574:4930503B20Rik UTSW 3 146650858 missense probably benign 0.02
R6830:4930503B20Rik UTSW 3 146650961 missense possibly damaging 0.90
R9771:4930503B20Rik UTSW 3 146650988 missense possibly damaging 0.73
Z1176:4930503B20Rik UTSW 3 146650956 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGTGAAGAAGACAATGGC -3'
(R):5'- AAATATGCTCTCGGAGGCCAC -3'

Sequencing Primer
(F):5'- CTTACCAACCACGTGAAGGATTGTG -3'
(R):5'- CGCCACACCTTCCAGAAG -3'
Posted On 2019-10-24