Mutagenetix > Incidental Mutations

Incidental Mutation 'R7604:Epha7'

588149

Institutional Source

Beutler Lab

Gene Symbol

Epha7

Ensembl Gene

ENSMUSG00000028289

Gene Name

Eph receptor A7

Synonyms

Ehk3, Hek11, Cek11, MDK1, Ebk, Mdk1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.732) question?

Stock #

R7604 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28813131-28967499 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 28871937 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 422 (S422L)

Ref Sequence

ENSEMBL: ENSMUSP00000029964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029964] [ENSMUST00000080934] [ENSMUST00000108191] [ENSMUST00000108194]

Predicted Effect

probably benign
Transcript: ENSMUST00000029964
AA Change: S422L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000029964
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
Pfam:EphA2_TM	557	630	4.4e-25	PFAM
TyrKc	633	890	8.84e-139	SMART
SAM	920	987	1.26e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080934
AA Change: S422L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000079735
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
transmembrane domain	556	578	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108191
AA Change: S422L

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103826
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
Pfam:EphA2_TM	556	626	2.9e-23	PFAM
TyrKc	629	886	8.84e-139	SMART
SAM	916	983	1.26e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108194
AA Change: S422L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103829
Gene: ENSMUSG00000028289
AA Change: S422L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EPH_lbd	32	205	3.24e-126	SMART
FN3	332	422	2.39e-8	SMART
FN3	443	524	3.12e-12	SMART
transmembrane domain	556	578	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Some homozygous mutants display anencephaly. Mutants also exhibit increased proliferation of neural progenitor cells in the lateral ventricle wall of the adult brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	T	3: 146,650,660	Y164*	probably null	Het
4932438A13Rik	A	G	3: 36,949,843		probably null	Het
9130019O22Rik	T	C	7: 127,386,535	T95A	unknown	Het
Abce1	G	A	8: 79,699,374	T258M	probably benign	Het
Actl7b	G	C	4: 56,740,693	P222A	probably benign	Het
Adam2	T	C	14: 66,056,541	N279S	probably benign	Het
Adamts13	A	G	2: 27,005,206	D1103G	probably benign	Het
Aff1	G	A	5: 103,847,809	S1089N	probably benign	Het
Ahcyl2	T	C	6: 29,768,556	S7P	unknown	Het
Anks1b	A	G	10: 90,260,846		probably null	Het
Azin1	A	C	15: 38,491,634	D359E	probably damaging	Het
Bahd1	A	G	2: 118,916,310	T137A	probably benign	Het
C1qbp	A	G	11: 70,978,772	S162P	probably damaging	Het
C1rb	A	G	6: 124,580,484	M527V	not run	Het
Ccdc88c	A	T	12: 100,930,547	D1381E	probably damaging	Het
Ccdc90b	A	G	7: 92,578,530	Y234C	probably damaging	Het
Cyp11b2	A	T	15: 74,853,750		probably null	Het
Dchs1	A	G	7: 105,765,982	V665A	probably damaging	Het
Dhx8	T	C	11: 101,764,797	S1119P	probably damaging	Het
Dnah6	T	C	6: 73,092,168	D2512G	probably damaging	Het
Dnah8	T	C	17: 30,813,095	Y4130H	probably damaging	Het
E4f1	G	T	17: 24,455,233	A19D	unknown	Het
Eftud2	T	C	11: 102,848,012	D517G	possibly damaging	Het
Epha6	T	A	16: 60,205,772	I436F	possibly damaging	Het
Ezh1	A	G	11: 101,217,029	M74T	probably benign	Het
Fam71d	C	A	12: 78,715,014	Q151K	probably damaging	Het
Galnt14	T	A	17: 73,504,921	K435M	possibly damaging	Het
Gde1	A	T	7: 118,705,536	Y39N	possibly damaging	Het
Gldn	G	A	9: 54,338,593	R476Q	probably benign	Het
Gm32742	G	T	9: 51,156,762	R307S	probably benign	Het
Gnao1	T	G	8: 93,944,344	N150K		Het
Gpr135	A	T	12: 72,069,867	D375E	possibly damaging	Het
Gria4	A	G	9: 4,464,315	M549T	probably damaging	Het
Grik3	C	A	4: 125,623,635	D90E	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911		probably null	Het
Hspd1	T	C	1: 55,080,337	E327G	probably benign	Het
Kif6	T	C	17: 49,671,101	I107T	probably damaging	Het
Kmt2e	C	T	5: 23,501,765	T1442M	not run	Het
Lama3	C	T	18: 12,500,493	H1561Y	possibly damaging	Het
Lpcat3	A	G	6: 124,702,530	N331S	probably benign	Het
Lrrc63	C	A	14: 75,084,969	W565L	possibly damaging	Het
Maats1	C	A	16: 38,298,236	E734*	probably null	Het
Malrd1	A	G	2: 15,925,192	N1503S	unknown	Het
Mcm7	C	T	5: 138,169,724	V38I	probably benign	Het
Mphosph9	C	T	5: 124,316,117	V106I	probably benign	Het
Mroh8	G	T	2: 157,269,564	L157I	possibly damaging	Het
Mta2	T	A	19: 8,945,836	S91T	probably damaging	Het
Muc5ac	A	T	7: 141,809,709	Q2252H	unknown	Het
Ndufs7	G	T	10: 80,253,697	V59L	probably benign	Het
Nrxn2	T	C	19: 6,531,961	L1642P	probably damaging	Het
Olfr1053	G	A	2: 86,314,900	P129S	probably damaging	Het
Pbxip1	A	T	3: 89,445,595	I183L	probably benign	Het
Peak1	A	T	9: 56,241,207	L1085*	probably null	Het
Phf20l1	A	G	15: 66,604,084	T189A	probably benign	Het
Poteg	T	A	8: 27,458,655		probably null	Het
Proc	G	A	18: 32,134,778		probably null	Het
Prr36	G	A	8: 4,214,836	R277C	unknown	Het
Ptpn3	T	C	4: 57,240,845	N257D	probably damaging	Het
Rnf5	C	A	17: 34,601,664	V150L	probably benign	Het
Sbf2	T	A	7: 110,378,067	Q666L	possibly damaging	Het
Sdk2	C	T	11: 113,829,969	R1378H	possibly damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sipa1l2	A	T	8: 125,419,272	V1681E	probably benign	Het
Slc15a5	A	T	6: 138,079,786	L44Q	probably damaging	Het
Slc29a1	C	A	17: 45,592,324		probably null	Het
Slc5a8	G	T	10: 88,904,960	V246F	possibly damaging	Het
Spint2	T	C	7: 29,258,519	E154G	probably damaging	Het
Sycp1	A	T	3: 102,913,433	S413T	probably damaging	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Trio	A	T	15: 27,736,445		probably null	Het
Unc13b	A	G	4: 43,170,102	Y310C	unknown	Het
Unc13b	A	G	4: 43,256,776	T1155A	possibly damaging	Het
Vmn2r79	A	G	7: 87,003,384		probably null	Het
Xpo7	T	A	14: 70,671,670	S803C	probably damaging	Het

Other mutations in Epha7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Epha7	APN	4	28961285	intron	probably benign
IGL00849:Epha7	APN	4	28870662	missense	possibly damaging	0.63
IGL00898:Epha7	APN	4	28938693	missense	probably damaging	1.00
IGL02036:Epha7	APN	4	28950509	missense	probably damaging	1.00
IGL02227:Epha7	APN	4	28821587	missense	possibly damaging	0.85
IGL02237:Epha7	APN	4	28949325	splice site	probably null
IGL02376:Epha7	APN	4	28951287	missense	probably damaging	1.00
IGL02424:Epha7	APN	4	28948790	intron	probably benign
IGL02519:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02522:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02524:Epha7	APN	4	28821494	missense	possibly damaging	0.91
IGL02602:Epha7	APN	4	28871877	missense	possibly damaging	0.88
PIT4514001:Epha7	UTSW	4	28961355	nonsense	probably null
R0001:Epha7	UTSW	4	28961279	intron	probably benign
R0011:Epha7	UTSW	4	28962564	missense	probably benign	0.03
R0011:Epha7	UTSW	4	28962564	missense	probably benign	0.03
R0310:Epha7	UTSW	4	28961301	missense	probably benign	0.33
R0373:Epha7	UTSW	4	28935700	splice site	probably null
R0496:Epha7	UTSW	4	28821292	missense	probably damaging	1.00
R0554:Epha7	UTSW	4	28951401	missense	probably damaging	1.00
R0632:Epha7	UTSW	4	28821104	missense	probably damaging	1.00
R1677:Epha7	UTSW	4	28947571	nonsense	probably null
R1883:Epha7	UTSW	4	28950362	missense	possibly damaging	0.58
R1919:Epha7	UTSW	4	28963969	missense	possibly damaging	0.48
R1952:Epha7	UTSW	4	28950474	missense	probably damaging	0.97
R1999:Epha7	UTSW	4	28938686	nonsense	probably null
R2187:Epha7	UTSW	4	28942648	missense	possibly damaging	0.63
R2308:Epha7	UTSW	4	28821503	missense	possibly damaging	0.91
R2417:Epha7	UTSW	4	28947579	missense	probably damaging	1.00
R3911:Epha7	UTSW	4	28938680	missense	probably benign	0.01
R4350:Epha7	UTSW	4	28950393	missense	probably damaging	0.98
R4688:Epha7	UTSW	4	28821367	missense	probably damaging	1.00
R4702:Epha7	UTSW	4	28961425	missense	probably damaging	1.00
R4957:Epha7	UTSW	4	28871892	missense	probably damaging	0.99
R5364:Epha7	UTSW	4	28950557	missense	probably damaging	1.00
R5661:Epha7	UTSW	4	28946217	intron	probably null
R5820:Epha7	UTSW	4	28949365	missense	probably damaging	1.00
R6038:Epha7	UTSW	4	28821521	missense	probably damaging	1.00
R6038:Epha7	UTSW	4	28821521	missense	probably damaging	1.00
R6592:Epha7	UTSW	4	28813482	critical splice donor site	probably null
R6783:Epha7	UTSW	4	28950528	missense	possibly damaging	0.94
R6991:Epha7	UTSW	4	28821489	missense	probably damaging	1.00
R7152:Epha7	UTSW	4	28935826	missense	possibly damaging	0.94
R7232:Epha7	UTSW	4	28951279	missense	probably damaging	1.00
R7261:Epha7	UTSW	4	28813418	missense	probably benign	0.04
R7365:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7367:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7368:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7413:Epha7	UTSW	4	28871838	missense	probably benign	0.00
R7603:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7605:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7607:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7608:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7609:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R7610:Epha7	UTSW	4	28871937	missense	probably benign	0.07
R8073:Epha7	UTSW	4	28821022	missense	probably damaging	1.00
R8263:Epha7	UTSW	4	28821149	missense	probably damaging	1.00
R8334:Epha7	UTSW	4	28938777	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- ATACTGTGTAAGCGGTGCAG -3'
(R):5'- TTTCCCCACCAGAACTATGGG -3'

Sequencing Primer
(F):5'- GCGGTGCAGTTGGGAAC -3'
(R):5'- CCAGAACTATGGGGATATTAAATGAC -3'

Posted On

2019-10-24