Incidental Mutation 'R7604:Actl7b'
ID588152
Institutional Source Beutler Lab
Gene Symbol Actl7b
Ensembl Gene ENSMUSG00000070980
Gene Nameactin-like 7b
SynonymsENSMUSG00000070980, Tact1, t-actin 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7604 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location56740005-56741443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 56740693 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 222 (P222A)
Ref Sequence ENSEMBL: ENSMUSP00000092693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
Predicted Effect probably benign
Transcript: ENSMUST00000095079
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095080
AA Change: P222A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980
AA Change: P222A

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181745
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7B), and related gene, ACTL7A, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7B gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. Unlike ACTL7A, the ACTL7B gene is expressed predominantly in the testis, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,650,660 Y164* probably null Het
4932438A13Rik A G 3: 36,949,843 probably null Het
9130019O22Rik T C 7: 127,386,535 T95A unknown Het
Abce1 G A 8: 79,699,374 T258M probably benign Het
Adam2 T C 14: 66,056,541 N279S probably benign Het
Adamts13 A G 2: 27,005,206 D1103G probably benign Het
Aff1 G A 5: 103,847,809 S1089N probably benign Het
Ahcyl2 T C 6: 29,768,556 S7P unknown Het
Anks1b A G 10: 90,260,846 probably null Het
Azin1 A C 15: 38,491,634 D359E probably damaging Het
Bahd1 A G 2: 118,916,310 T137A probably benign Het
C1qbp A G 11: 70,978,772 S162P probably damaging Het
C1rb A G 6: 124,580,484 M527V not run Het
Ccdc88c A T 12: 100,930,547 D1381E probably damaging Het
Ccdc90b A G 7: 92,578,530 Y234C probably damaging Het
Cyp11b2 A T 15: 74,853,750 probably null Het
Dchs1 A G 7: 105,765,982 V665A probably damaging Het
Dhx8 T C 11: 101,764,797 S1119P probably damaging Het
Dnah6 T C 6: 73,092,168 D2512G probably damaging Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
E4f1 G T 17: 24,455,233 A19D unknown Het
Eftud2 T C 11: 102,848,012 D517G possibly damaging Het
Epha6 T A 16: 60,205,772 I436F possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ezh1 A G 11: 101,217,029 M74T probably benign Het
Fam71d C A 12: 78,715,014 Q151K probably damaging Het
Galnt14 T A 17: 73,504,921 K435M possibly damaging Het
Gde1 A T 7: 118,705,536 Y39N possibly damaging Het
Gldn G A 9: 54,338,593 R476Q probably benign Het
Gm32742 G T 9: 51,156,762 R307S probably benign Het
Gnao1 T G 8: 93,944,344 N150K Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gria4 A G 9: 4,464,315 M549T probably damaging Het
Grik3 C A 4: 125,623,635 D90E probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hspd1 T C 1: 55,080,337 E327G probably benign Het
Kif6 T C 17: 49,671,101 I107T probably damaging Het
Kmt2e C T 5: 23,501,765 T1442M not run Het
Lama3 C T 18: 12,500,493 H1561Y possibly damaging Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrrc63 C A 14: 75,084,969 W565L possibly damaging Het
Maats1 C A 16: 38,298,236 E734* probably null Het
Malrd1 A G 2: 15,925,192 N1503S unknown Het
Mcm7 C T 5: 138,169,724 V38I probably benign Het
Mphosph9 C T 5: 124,316,117 V106I probably benign Het
Mroh8 G T 2: 157,269,564 L157I possibly damaging Het
Mta2 T A 19: 8,945,836 S91T probably damaging Het
Muc5ac A T 7: 141,809,709 Q2252H unknown Het
Ndufs7 G T 10: 80,253,697 V59L probably benign Het
Nrxn2 T C 19: 6,531,961 L1642P probably damaging Het
Olfr1053 G A 2: 86,314,900 P129S probably damaging Het
Pbxip1 A T 3: 89,445,595 I183L probably benign Het
Peak1 A T 9: 56,241,207 L1085* probably null Het
Phf20l1 A G 15: 66,604,084 T189A probably benign Het
Poteg T A 8: 27,458,655 probably null Het
Proc G A 18: 32,134,778 probably null Het
Prr36 G A 8: 4,214,836 R277C unknown Het
Ptpn3 T C 4: 57,240,845 N257D probably damaging Het
Rnf5 C A 17: 34,601,664 V150L probably benign Het
Sbf2 T A 7: 110,378,067 Q666L possibly damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sipa1l2 A T 8: 125,419,272 V1681E probably benign Het
Slc15a5 A T 6: 138,079,786 L44Q probably damaging Het
Slc29a1 C A 17: 45,592,324 probably null Het
Slc5a8 G T 10: 88,904,960 V246F possibly damaging Het
Spint2 T C 7: 29,258,519 E154G probably damaging Het
Sycp1 A T 3: 102,913,433 S413T probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A T 15: 27,736,445 probably null Het
Unc13b A G 4: 43,170,102 Y310C unknown Het
Unc13b A G 4: 43,256,776 T1155A possibly damaging Het
Vmn2r79 A G 7: 87,003,384 probably null Het
Xpo7 T A 14: 70,671,670 S803C probably damaging Het
Other mutations in Actl7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Actl7b APN 4 56740677 missense probably damaging 1.00
IGL02252:Actl7b APN 4 56741205 missense probably damaging 0.97
IGL02927:Actl7b APN 4 56740609 missense probably damaging 1.00
IGL03370:Actl7b APN 4 56741173 missense probably damaging 1.00
R0294:Actl7b UTSW 4 56740848 missense possibly damaging 0.83
R1711:Actl7b UTSW 4 56740165 nonsense probably null
R4773:Actl7b UTSW 4 56740972 missense probably benign
R6110:Actl7b UTSW 4 56740224 missense probably damaging 1.00
R6423:Actl7b UTSW 4 56741213 missense probably benign 0.03
R7039:Actl7b UTSW 4 56741022 missense probably damaging 0.98
R7250:Actl7b UTSW 4 56741035 missense probably benign 0.00
R8025:Actl7b UTSW 4 56741137 missense probably damaging 1.00
R8352:Actl7b UTSW 4 56740251 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAGCATCTCAGAGCAGC -3'
(R):5'- GAAGTACGCTGAGCTCCTGTTC -3'

Sequencing Primer
(F):5'- GTAGTCCACATGCAGCTCGTCTAG -3'
(R):5'- TGAGCTCCTGTTCGAGACC -3'
Posted On2019-10-24