Incidental Mutation 'R7604:Kmt2e'
ID588156
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7604 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23501765 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1442 (T1442M)
Ref Sequence ENSEMBL: ENSMUSP00000092569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962]
Predicted Effect not run
Transcript: ENSMUST00000094962
AA Change: T1442M
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: T1442M

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,650,660 Y164* probably null Het
4932438A13Rik A G 3: 36,949,843 probably null Het
9130019O22Rik T C 7: 127,386,535 T95A unknown Het
Abce1 G A 8: 79,699,374 T258M probably benign Het
Actl7b G C 4: 56,740,693 P222A probably benign Het
Adam2 T C 14: 66,056,541 N279S probably benign Het
Adamts13 A G 2: 27,005,206 D1103G probably benign Het
Aff1 G A 5: 103,847,809 S1089N probably benign Het
Ahcyl2 T C 6: 29,768,556 S7P unknown Het
Anks1b A G 10: 90,260,846 probably null Het
Azin1 A C 15: 38,491,634 D359E probably damaging Het
Bahd1 A G 2: 118,916,310 T137A probably benign Het
C1qbp A G 11: 70,978,772 S162P probably damaging Het
C1rb A G 6: 124,580,484 M527V not run Het
Ccdc88c A T 12: 100,930,547 D1381E probably damaging Het
Ccdc90b A G 7: 92,578,530 Y234C probably damaging Het
Cyp11b2 A T 15: 74,853,750 probably null Het
Dchs1 A G 7: 105,765,982 V665A probably damaging Het
Dhx8 T C 11: 101,764,797 S1119P probably damaging Het
Dnah6 T C 6: 73,092,168 D2512G probably damaging Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
E4f1 G T 17: 24,455,233 A19D unknown Het
Eftud2 T C 11: 102,848,012 D517G possibly damaging Het
Epha6 T A 16: 60,205,772 I436F possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ezh1 A G 11: 101,217,029 M74T probably benign Het
Fam71d C A 12: 78,715,014 Q151K probably damaging Het
Galnt14 T A 17: 73,504,921 K435M possibly damaging Het
Gde1 A T 7: 118,705,536 Y39N possibly damaging Het
Gldn G A 9: 54,338,593 R476Q probably benign Het
Gm32742 G T 9: 51,156,762 R307S probably benign Het
Gnao1 T G 8: 93,944,344 N150K Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gria4 A G 9: 4,464,315 M549T probably damaging Het
Grik3 C A 4: 125,623,635 D90E probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hspd1 T C 1: 55,080,337 E327G probably benign Het
Kif6 T C 17: 49,671,101 I107T probably damaging Het
Lama3 C T 18: 12,500,493 H1561Y possibly damaging Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrrc63 C A 14: 75,084,969 W565L possibly damaging Het
Maats1 C A 16: 38,298,236 E734* probably null Het
Malrd1 A G 2: 15,925,192 N1503S unknown Het
Mcm7 C T 5: 138,169,724 V38I probably benign Het
Mphosph9 C T 5: 124,316,117 V106I probably benign Het
Mroh8 G T 2: 157,269,564 L157I possibly damaging Het
Mta2 T A 19: 8,945,836 S91T probably damaging Het
Muc5ac A T 7: 141,809,709 Q2252H unknown Het
Ndufs7 G T 10: 80,253,697 V59L probably benign Het
Nrxn2 T C 19: 6,531,961 L1642P probably damaging Het
Olfr1053 G A 2: 86,314,900 P129S probably damaging Het
Pbxip1 A T 3: 89,445,595 I183L probably benign Het
Peak1 A T 9: 56,241,207 L1085* probably null Het
Phf20l1 A G 15: 66,604,084 T189A probably benign Het
Poteg T A 8: 27,458,655 probably null Het
Proc G A 18: 32,134,778 probably null Het
Prr36 G A 8: 4,214,836 R277C unknown Het
Ptpn3 T C 4: 57,240,845 N257D probably damaging Het
Rnf5 C A 17: 34,601,664 V150L probably benign Het
Sbf2 T A 7: 110,378,067 Q666L possibly damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sipa1l2 A T 8: 125,419,272 V1681E probably benign Het
Slc15a5 A T 6: 138,079,786 L44Q probably damaging Het
Slc29a1 C A 17: 45,592,324 probably null Het
Slc5a8 G T 10: 88,904,960 V246F possibly damaging Het
Spint2 T C 7: 29,258,519 E154G probably damaging Het
Sycp1 A T 3: 102,913,433 S413T probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A T 15: 27,736,445 probably null Het
Unc13b A G 4: 43,170,102 Y310C unknown Het
Unc13b A G 4: 43,256,776 T1155A possibly damaging Het
Vmn2r79 A G 7: 87,003,384 probably null Het
Xpo7 T A 14: 70,671,670 S803C probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
R8137:Kmt2e UTSW 5 23501954 missense probably damaging 1.00
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers
Posted On2019-10-24