Mutagenetix > Incidental Mutation

Incidental Mutation 'R7604:Aff1'

588157

Institutional Source

Beutler Lab

Gene Symbol

Aff1

Ensembl Gene

ENSMUSG00000029313

Gene Name

AF4/FMR2 family, member 1

Synonyms

9630032B01Rik, Af4, Rob, Mllt2h

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.381) question?

Stock #

R7604 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103692374-103855322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103847809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1089 (S1089N)

Ref Sequence

ENSEMBL: ENSMUSP00000059744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031256
AA Change: S1097N

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: S1097N

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	1223	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000054979
AA Change: S1089N

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: S1089N

Domain	Start	End	E-Value	Type
Pfam:AF-4	8	1216	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	T	3: 146,650,660	Y164*	probably null	Het
4932438A13Rik	A	G	3: 36,949,843		probably null	Het
9130019O22Rik	T	C	7: 127,386,535	T95A	unknown	Het
Abce1	G	A	8: 79,699,374	T258M	probably benign	Het
Actl7b	G	C	4: 56,740,693	P222A	probably benign	Het
Adam2	T	C	14: 66,056,541	N279S	probably benign	Het
Adamts13	A	G	2: 27,005,206	D1103G	probably benign	Het
Ahcyl2	T	C	6: 29,768,556	S7P	unknown	Het
Anks1b	A	G	10: 90,260,846		probably null	Het
Azin1	A	C	15: 38,491,634	D359E	probably damaging	Het
Bahd1	A	G	2: 118,916,310	T137A	probably benign	Het
C1qbp	A	G	11: 70,978,772	S162P	probably damaging	Het
C1rb	A	G	6: 124,580,484	M527V	not run	Het
Ccdc88c	A	T	12: 100,930,547	D1381E	probably damaging	Het
Ccdc90b	A	G	7: 92,578,530	Y234C	probably damaging	Het
Cyp11b2	A	T	15: 74,853,750		probably null	Het
Dchs1	A	G	7: 105,765,982	V665A	probably damaging	Het
Dhx8	T	C	11: 101,764,797	S1119P	probably damaging	Het
Dnah6	T	C	6: 73,092,168	D2512G	probably damaging	Het
Dnah8	T	C	17: 30,813,095	Y4130H	probably damaging	Het
E4f1	G	T	17: 24,455,233	A19D	unknown	Het
Eftud2	T	C	11: 102,848,012	D517G	possibly damaging	Het
Epha6	T	A	16: 60,205,772	I436F	possibly damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ezh1	A	G	11: 101,217,029	M74T	probably benign	Het
Fam71d	C	A	12: 78,715,014	Q151K	probably damaging	Het
Galnt14	T	A	17: 73,504,921	K435M	possibly damaging	Het
Gde1	A	T	7: 118,705,536	Y39N	possibly damaging	Het
Gldn	G	A	9: 54,338,593	R476Q	probably benign	Het
Gm32742	G	T	9: 51,156,762	R307S	probably benign	Het
Gnao1	T	G	8: 93,944,344	N150K		Het
Gpr135	A	T	12: 72,069,867	D375E	possibly damaging	Het
Gria4	A	G	9: 4,464,315	M549T	probably damaging	Het
Grik3	C	A	4: 125,623,635	D90E	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Hspd1	T	C	1: 55,080,337	E327G	probably benign	Het
Kif6	T	C	17: 49,671,101	I107T	probably damaging	Het
Kmt2e	C	T	5: 23,501,765	T1442M	not run	Het
Lama3	C	T	18: 12,500,493	H1561Y	possibly damaging	Het
Lpcat3	A	G	6: 124,702,530	N331S	probably benign	Het
Lrrc63	C	A	14: 75,084,969	W565L	possibly damaging	Het
Maats1	C	A	16: 38,298,236	E734*	probably null	Het
Malrd1	A	G	2: 15,925,192	N1503S	unknown	Het
Mcm7	C	T	5: 138,169,724	V38I	probably benign	Het
Mphosph9	C	T	5: 124,316,117	V106I	probably benign	Het
Mroh8	G	T	2: 157,269,564	L157I	possibly damaging	Het
Mta2	T	A	19: 8,945,836	S91T	probably damaging	Het
Muc5ac	A	T	7: 141,809,709	Q2252H	unknown	Het
Ndufs7	G	T	10: 80,253,697	V59L	probably benign	Het
Nrxn2	T	C	19: 6,531,961	L1642P	probably damaging	Het
Olfr1053	G	A	2: 86,314,900	P129S	probably damaging	Het
Pbxip1	A	T	3: 89,445,595	I183L	probably benign	Het
Peak1	A	T	9: 56,241,207	L1085*	probably null	Het
Phf20l1	A	G	15: 66,604,084	T189A	probably benign	Het
Poteg	T	A	8: 27,458,655		probably null	Het
Proc	G	A	18: 32,134,778		probably null	Het
Prr36	G	A	8: 4,214,836	R277C	unknown	Het
Ptpn3	T	C	4: 57,240,845	N257D	probably damaging	Het
Rnf5	C	A	17: 34,601,664	V150L	probably benign	Het
Sbf2	T	A	7: 110,378,067	Q666L	possibly damaging	Het
Sdk2	C	T	11: 113,829,969	R1378H	possibly damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sipa1l2	A	T	8: 125,419,272	V1681E	probably benign	Het
Slc15a5	A	T	6: 138,079,786	L44Q	probably damaging	Het
Slc29a1	C	A	17: 45,592,324		probably null	Het
Slc5a8	G	T	10: 88,904,960	V246F	possibly damaging	Het
Spint2	T	C	7: 29,258,519	E154G	probably damaging	Het
Sycp1	A	T	3: 102,913,433	S413T	probably damaging	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Trio	A	T	15: 27,736,445		probably null	Het
Unc13b	A	G	4: 43,170,102	Y310C	unknown	Het
Unc13b	A	G	4: 43,256,776	T1155A	possibly damaging	Het
Vmn2r79	A	G	7: 87,003,384		probably null	Het
Xpo7	T	A	14: 70,671,670	S803C	probably damaging	Het

Other mutations in Aff1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Aff1	APN	5	103784077	missense	probably damaging	1.00
IGL02060:Aff1	APN	5	103783849	missense	possibly damaging	0.51
IGL02081:Aff1	APN	5	103834305	missense	probably damaging	1.00
IGL02108:Aff1	APN	5	103811109	critical splice donor site	probably null
IGL03056:Aff1	APN	5	103811081	missense	probably damaging	0.99
IGL03332:Aff1	APN	5	103841105	nonsense	probably null
IGL03340:Aff1	APN	5	103783804	missense	possibly damaging	0.76
IGL03382:Aff1	APN	5	103841060	missense	possibly damaging	0.86
PIT4495001:Aff1	UTSW	5	103849525	missense	probably benign	0.16
R0013:Aff1	UTSW	5	103828484	nonsense	probably null
R0219:Aff1	UTSW	5	103811040	splice site	probably benign
R0520:Aff1	UTSW	5	103847751	nonsense	probably null
R0607:Aff1	UTSW	5	103828454	missense	probably damaging	1.00
R0883:Aff1	UTSW	5	103826138	splice site	probably benign
R1662:Aff1	UTSW	5	103841057	missense	probably damaging	0.99
R1730:Aff1	UTSW	5	103833512	missense	probably damaging	1.00
R1850:Aff1	UTSW	5	103833907	missense	probably damaging	1.00
R3411:Aff1	UTSW	5	103754706	start codon destroyed	probably null	0.53
R4007:Aff1	UTSW	5	103784222	missense	probably benign	0.15
R4207:Aff1	UTSW	5	103818988	critical splice donor site	probably null
R4702:Aff1	UTSW	5	103811069	missense	probably damaging	1.00
R4730:Aff1	UTSW	5	103843073	missense	possibly damaging	0.95
R4784:Aff1	UTSW	5	103847039	nonsense	probably null
R5166:Aff1	UTSW	5	103754657	start gained	probably benign
R5294:Aff1	UTSW	5	103811157	intron	probably benign
R5435:Aff1	UTSW	5	103754332	unclassified	probably benign
R5436:Aff1	UTSW	5	103783870	missense	probably damaging	1.00
R6065:Aff1	UTSW	5	103842252	missense	probably damaging	1.00
R6114:Aff1	UTSW	5	103842297	missense	probably damaging	0.97
R6298:Aff1	UTSW	5	103754720	missense	possibly damaging	0.68
R7095:Aff1	UTSW	5	103843085	missense	probably damaging	0.97
R7261:Aff1	UTSW	5	103828379	missense	probably damaging	0.97
R7350:Aff1	UTSW	5	103847092	missense	probably benign	0.28
R7423:Aff1	UTSW	5	103847101	missense	probably damaging	1.00
R7469:Aff1	UTSW	5	103833547	missense	probably benign	0.00
R7607:Aff1	UTSW	5	103849459	missense	possibly damaging	0.72
R8014:Aff1	UTSW	5	103833869	missense	possibly damaging	0.82
R8219:Aff1	UTSW	5	103846333	missense	probably damaging	1.00
R8315:Aff1	UTSW	5	103811090	missense	probably damaging	0.99
R8837:Aff1	UTSW	5	103834212	missense	possibly damaging	0.77
R8957:Aff1	UTSW	5	103833768	missense	possibly damaging	0.82
R9159:Aff1	UTSW	5	103842265	missense	possibly damaging	0.89
R9377:Aff1	UTSW	5	103833819	missense	probably damaging	0.96
R9381:Aff1	UTSW	5	103833867	missense	possibly damaging	0.85
R9705:Aff1	UTSW	5	103784410	missense	possibly damaging	0.88
R9725:Aff1	UTSW	5	103847065	missense	probably damaging	0.99
R9764:Aff1	UTSW	5	103849499	missense	probably damaging	1.00
Z1177:Aff1	UTSW	5	103783753	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- AGAACCCAGTATGCTCACAGG -3'
(R):5'- ACCTGTTTCTCAGAGGGACG -3'

Sequencing Primer
(F):5'- TATGCTCACAGGGGAGGACTG -3'
(R):5'- CGGTGTAGCTAACGGTTTAAAG -3'

Posted On

2019-10-24