Incidental Mutation 'R7604:Slc5a8'
ID588183
Institutional Source Beutler Lab
Gene Symbol Slc5a8
Ensembl Gene ENSMUSG00000020062
Gene Namesolute carrier family 5 (iodide transporter), member 8
SynonymsSMCT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7604 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location88885992-88929515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88904960 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 246 (V246F)
Ref Sequence ENSEMBL: ENSMUSP00000020255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020255
AA Change: V246F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: V246F

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:SSF 45 449 2.6e-38 PFAM
low complexity region 462 478 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,650,660 Y164* probably null Het
9130019O22Rik T C 7: 127,386,535 T95A unknown Het
Abce1 G A 8: 79,699,374 T258M probably benign Het
Actl7b G C 4: 56,740,693 P222A probably benign Het
Adam2 T C 14: 66,056,541 N279S probably benign Het
Adamts13 A G 2: 27,005,206 D1103G probably benign Het
Aff1 G A 5: 103,847,809 S1089N probably benign Het
Ahcyl2 T C 6: 29,768,556 S7P unknown Het
Azin1 A C 15: 38,491,634 D359E probably damaging Het
Bahd1 A G 2: 118,916,310 T137A probably benign Het
C1qbp A G 11: 70,978,772 S162P probably damaging Het
C1rb A G 6: 124,580,484 M527V not run Het
Ccdc88c A T 12: 100,930,547 D1381E probably damaging Het
Ccdc90b A G 7: 92,578,530 Y234C probably damaging Het
Dchs1 A G 7: 105,765,982 V665A probably damaging Het
Dhx8 T C 11: 101,764,797 S1119P probably damaging Het
Dnah6 T C 6: 73,092,168 D2512G probably damaging Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
E4f1 G T 17: 24,455,233 A19D unknown Het
Eftud2 T C 11: 102,848,012 D517G possibly damaging Het
Epha6 T A 16: 60,205,772 I436F possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ezh1 A G 11: 101,217,029 M74T probably benign Het
Fam71d C A 12: 78,715,014 Q151K probably damaging Het
Galnt14 T A 17: 73,504,921 K435M possibly damaging Het
Gde1 A T 7: 118,705,536 Y39N possibly damaging Het
Gldn G A 9: 54,338,593 R476Q probably benign Het
Gm32742 G T 9: 51,156,762 R307S probably benign Het
Gnao1 T G 8: 93,944,344 N150K Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gria4 A G 9: 4,464,315 M549T probably damaging Het
Grik3 C A 4: 125,623,635 D90E probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hspd1 T C 1: 55,080,337 E327G probably benign Het
Kif6 T C 17: 49,671,101 I107T probably damaging Het
Kmt2e C T 5: 23,501,765 T1442M not run Het
Lama3 C T 18: 12,500,493 H1561Y possibly damaging Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrrc63 C A 14: 75,084,969 W565L possibly damaging Het
Maats1 C A 16: 38,298,236 E734* probably null Het
Malrd1 A G 2: 15,925,192 N1503S unknown Het
Mcm7 C T 5: 138,169,724 V38I probably benign Het
Mphosph9 C T 5: 124,316,117 V106I probably benign Het
Mroh8 G T 2: 157,269,564 L157I possibly damaging Het
Mta2 T A 19: 8,945,836 S91T probably damaging Het
Muc5ac A T 7: 141,809,709 Q2252H unknown Het
Ndufs7 G T 10: 80,253,697 V59L probably benign Het
Nrxn2 T C 19: 6,531,961 L1642P probably damaging Het
Olfr1053 G A 2: 86,314,900 P129S probably damaging Het
Pbxip1 A T 3: 89,445,595 I183L probably benign Het
Peak1 A T 9: 56,241,207 L1085* probably null Het
Phf20l1 A G 15: 66,604,084 T189A probably benign Het
Prr36 G A 8: 4,214,836 R277C unknown Het
Ptpn3 T C 4: 57,240,845 N257D probably damaging Het
Rnf5 C A 17: 34,601,664 V150L probably benign Het
Sbf2 T A 7: 110,378,067 Q666L possibly damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sipa1l2 A T 8: 125,419,272 V1681E probably benign Het
Slc15a5 A T 6: 138,079,786 L44Q probably damaging Het
Spint2 T C 7: 29,258,519 E154G probably damaging Het
Sycp1 A T 3: 102,913,433 S413T probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A T 15: 27,736,445 probably null Het
Unc13b A G 4: 43,170,102 Y310C unknown Het
Unc13b A G 4: 43,256,776 T1155A possibly damaging Het
Vmn2r79 A G 7: 87,003,384 probably null Het
Xpo7 T A 14: 70,671,670 S803C probably damaging Het
Other mutations in Slc5a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Slc5a8 APN 10 88908040 missense possibly damaging 0.91
IGL00902:Slc5a8 APN 10 88919461 missense probably benign 0.03
IGL00960:Slc5a8 APN 10 88921765 missense probably benign 0.21
IGL01109:Slc5a8 APN 10 88906392 missense possibly damaging 0.95
IGL01365:Slc5a8 APN 10 88892097 splice site probably benign
IGL01418:Slc5a8 APN 10 88905033 missense probably damaging 1.00
IGL01823:Slc5a8 APN 10 88919472 nonsense probably null
IGL02116:Slc5a8 APN 10 88919500 missense probably benign
IGL03109:Slc5a8 APN 10 88906416 splice site probably benign
PIT4585001:Slc5a8 UTSW 10 88886503 missense probably damaging 1.00
R0010:Slc5a8 UTSW 10 88886590 missense probably benign 0.03
R0418:Slc5a8 UTSW 10 88886558 missense probably benign 0.01
R1233:Slc5a8 UTSW 10 88918442 missense probably damaging 1.00
R1656:Slc5a8 UTSW 10 88925786 critical splice donor site probably null
R1769:Slc5a8 UTSW 10 88919464 missense probably benign
R1769:Slc5a8 UTSW 10 88919466 nonsense probably null
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2870:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R2873:Slc5a8 UTSW 10 88904963 missense probably benign 0.01
R3883:Slc5a8 UTSW 10 88902463 missense possibly damaging 0.89
R4207:Slc5a8 UTSW 10 88911413 missense probably damaging 1.00
R4731:Slc5a8 UTSW 10 88925787 critical splice donor site probably null
R4880:Slc5a8 UTSW 10 88892024 missense probably damaging 1.00
R4969:Slc5a8 UTSW 10 88904912 splice site probably null
R4998:Slc5a8 UTSW 10 88908057 critical splice donor site probably null
R5009:Slc5a8 UTSW 10 88909654 missense probably benign 0.07
R5068:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5069:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5070:Slc5a8 UTSW 10 88886598 missense possibly damaging 0.82
R5130:Slc5a8 UTSW 10 88926215 missense probably benign
R5141:Slc5a8 UTSW 10 88919560 critical splice donor site probably null
R5252:Slc5a8 UTSW 10 88906347 missense probably damaging 1.00
R5659:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5660:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R5661:Slc5a8 UTSW 10 88919428 missense possibly damaging 0.89
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6039:Slc5a8 UTSW 10 88886574 missense probably benign 0.00
R6378:Slc5a8 UTSW 10 88905054 missense probably damaging 1.00
R7214:Slc5a8 UTSW 10 88919502 missense probably benign
R7255:Slc5a8 UTSW 10 88909631 missense probably damaging 1.00
R7526:Slc5a8 UTSW 10 88902491 missense probably damaging 1.00
R7688:Slc5a8 UTSW 10 88921699 missense probably damaging 1.00
R7869:Slc5a8 UTSW 10 88921705 missense probably benign 0.15
R7952:Slc5a8 UTSW 10 88921705 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGCTTCCTAAGACTATGGGAGAAC -3'
(R):5'- GAATCACCCACCTGCCATTG -3'

Sequencing Primer
(F):5'- CATCTAGAATCTCCTAATATCTGGA -3'
(R):5'- GCCATTGCTGATCATTTATACTTGG -3'
Posted On2019-10-24