Incidental Mutation 'R7604:Eftud2'
ID588187
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Nameelongation factor Tu GTP binding domain containing 2
Synonyms116kDa, Snrp116, U5-116kD
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7604 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location102838473-102880985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102848012 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 517 (D517G)
Ref Sequence ENSEMBL: ENSMUSP00000102675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000173679]
Predicted Effect probably damaging
Transcript: ENSMUST00000021306
AA Change: D518G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: D518G

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107060
AA Change: D517G

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: D517G

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172611
SMART Domains Protein: ENSMUSP00000134316
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 85 98 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173679
AA Change: D508G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: D508G

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Meta Mutation Damage Score 0.5181 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,650,660 Y164* probably null Het
4932438A13Rik A G 3: 36,949,843 probably null Het
9130019O22Rik T C 7: 127,386,535 T95A unknown Het
Abce1 G A 8: 79,699,374 T258M probably benign Het
Actl7b G C 4: 56,740,693 P222A probably benign Het
Adam2 T C 14: 66,056,541 N279S probably benign Het
Adamts13 A G 2: 27,005,206 D1103G probably benign Het
Aff1 G A 5: 103,847,809 S1089N probably benign Het
Ahcyl2 T C 6: 29,768,556 S7P unknown Het
Anks1b A G 10: 90,260,846 probably null Het
Azin1 A C 15: 38,491,634 D359E probably damaging Het
Bahd1 A G 2: 118,916,310 T137A probably benign Het
C1qbp A G 11: 70,978,772 S162P probably damaging Het
C1rb A G 6: 124,580,484 M527V not run Het
Ccdc88c A T 12: 100,930,547 D1381E probably damaging Het
Ccdc90b A G 7: 92,578,530 Y234C probably damaging Het
Cyp11b2 A T 15: 74,853,750 probably null Het
Dchs1 A G 7: 105,765,982 V665A probably damaging Het
Dhx8 T C 11: 101,764,797 S1119P probably damaging Het
Dnah6 T C 6: 73,092,168 D2512G probably damaging Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
E4f1 G T 17: 24,455,233 A19D unknown Het
Epha6 T A 16: 60,205,772 I436F possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ezh1 A G 11: 101,217,029 M74T probably benign Het
Fam71d C A 12: 78,715,014 Q151K probably damaging Het
Galnt14 T A 17: 73,504,921 K435M possibly damaging Het
Gde1 A T 7: 118,705,536 Y39N possibly damaging Het
Gldn G A 9: 54,338,593 R476Q probably benign Het
Gm32742 G T 9: 51,156,762 R307S probably benign Het
Gnao1 T G 8: 93,944,344 N150K Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gria4 A G 9: 4,464,315 M549T probably damaging Het
Grik3 C A 4: 125,623,635 D90E probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hspd1 T C 1: 55,080,337 E327G probably benign Het
Kif6 T C 17: 49,671,101 I107T probably damaging Het
Kmt2e C T 5: 23,501,765 T1442M not run Het
Lama3 C T 18: 12,500,493 H1561Y possibly damaging Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrrc63 C A 14: 75,084,969 W565L possibly damaging Het
Maats1 C A 16: 38,298,236 E734* probably null Het
Malrd1 A G 2: 15,925,192 N1503S unknown Het
Mcm7 C T 5: 138,169,724 V38I probably benign Het
Mphosph9 C T 5: 124,316,117 V106I probably benign Het
Mroh8 G T 2: 157,269,564 L157I possibly damaging Het
Mta2 T A 19: 8,945,836 S91T probably damaging Het
Muc5ac A T 7: 141,809,709 Q2252H unknown Het
Ndufs7 G T 10: 80,253,697 V59L probably benign Het
Nrxn2 T C 19: 6,531,961 L1642P probably damaging Het
Olfr1053 G A 2: 86,314,900 P129S probably damaging Het
Pbxip1 A T 3: 89,445,595 I183L probably benign Het
Peak1 A T 9: 56,241,207 L1085* probably null Het
Phf20l1 A G 15: 66,604,084 T189A probably benign Het
Poteg T A 8: 27,458,655 probably null Het
Proc G A 18: 32,134,778 probably null Het
Prr36 G A 8: 4,214,836 R277C unknown Het
Ptpn3 T C 4: 57,240,845 N257D probably damaging Het
Rnf5 C A 17: 34,601,664 V150L probably benign Het
Sbf2 T A 7: 110,378,067 Q666L possibly damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sipa1l2 A T 8: 125,419,272 V1681E probably benign Het
Slc15a5 A T 6: 138,079,786 L44Q probably damaging Het
Slc29a1 C A 17: 45,592,324 probably null Het
Slc5a8 G T 10: 88,904,960 V246F possibly damaging Het
Spint2 T C 7: 29,258,519 E154G probably damaging Het
Sycp1 A T 3: 102,913,433 S413T probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A T 15: 27,736,445 probably null Het
Unc13b A G 4: 43,170,102 Y310C unknown Het
Unc13b A G 4: 43,256,776 T1155A possibly damaging Het
Vmn2r79 A G 7: 87,003,384 probably null Het
Xpo7 T A 14: 70,671,670 S803C probably damaging Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102865563 splice site probably benign
IGL01765:Eftud2 APN 11 102839256 missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102869127 missense probably benign 0.08
IGL02161:Eftud2 APN 11 102854876 splice site probably benign
IGL02165:Eftud2 APN 11 102851747 splice site probably benign
IGL02218:Eftud2 APN 11 102870213 missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102851754 splice site probably null
IGL02664:Eftud2 APN 11 102841712 missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102846614 missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102870256 splice site probably benign
IGL02870:Eftud2 APN 11 102862626 missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102870183 missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102868617 missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102864725 missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102864801 splice site probably benign
R0463:Eftud2 UTSW 11 102864771 missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102844222 missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102846620 missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102849184 missense probably benign
R1079:Eftud2 UTSW 11 102840044 nonsense probably null
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1220:Eftud2 UTSW 11 102851747 splice site probably benign
R1438:Eftud2 UTSW 11 102860042 missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102839440 missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102854771 splice site probably benign
R2270:Eftud2 UTSW 11 102864781 missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102844180 missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102841463 splice site probably null
R3892:Eftud2 UTSW 11 102846187 missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102860110 missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102839416 splice site probably null
R4794:Eftud2 UTSW 11 102870177 missense probably benign 0.14
R4841:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102867844 critical splice donor site probably null
R5208:Eftud2 UTSW 11 102841185 missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102840057 missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102864780 missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102838623 nonsense probably null
R7886:Eftud2 UTSW 11 102840108 missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8019:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8139:Eftud2 UTSW 11 102867859 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTGAGCTACCTTTCAGCCC -3'
(R):5'- GGTTAAAGCTGTTTCCTGTCCC -3'

Sequencing Primer
(F):5'- CCTTCAGAACTAGGTGTCAACAGTG -3'
(R):5'- AAAGCTGTTTCCTGTCCCCTCTG -3'
Posted On2019-10-24