Incidental Mutation 'R7604:Ccdc88c'
ID588191
Institutional Source Beutler Lab
Gene Symbol Ccdc88c
Ensembl Gene ENSMUSG00000021182
Gene Namecoiled-coil domain containing 88C
Synonyms0610010D24Rik, Daple
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7604 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location100911523-101029056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100930547 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1381 (D1381E)
Ref Sequence ENSEMBL: ENSMUSP00000068629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096]
Predicted Effect probably damaging
Transcript: ENSMUST00000068411
AA Change: D1381E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: D1381E

DomainStartEndE-ValueType
Pfam:HOOK 7 586 5.9e-37 PFAM
low complexity region 601 613 N/A INTRINSIC
low complexity region 617 634 N/A INTRINSIC
Blast:BRLZ 668 719 3e-8 BLAST
low complexity region 724 744 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
Blast:BRLZ 948 1007 6e-15 BLAST
coiled coil region 1035 1085 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1129 1252 N/A INTRINSIC
coiled coil region 1312 1384 N/A INTRINSIC
low complexity region 1430 1439 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
low complexity region 1698 1709 N/A INTRINSIC
internal_repeat_1 1721 1778 6.97e-6 PROSPERO
low complexity region 1788 1808 N/A INTRINSIC
internal_repeat_1 1934 1989 6.97e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000085096
AA Change: D1388E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: D1388E

DomainStartEndE-ValueType
Pfam:HOOK 13 597 2.5e-41 PFAM
low complexity region 608 620 N/A INTRINSIC
low complexity region 624 641 N/A INTRINSIC
Blast:BRLZ 675 726 3e-8 BLAST
low complexity region 731 751 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 854 873 N/A INTRINSIC
Blast:BRLZ 955 1014 5e-15 BLAST
coiled coil region 1042 1092 N/A INTRINSIC
low complexity region 1102 1117 N/A INTRINSIC
coiled coil region 1136 1259 N/A INTRINSIC
coiled coil region 1319 1391 N/A INTRINSIC
low complexity region 1437 1446 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1569 1590 N/A INTRINSIC
low complexity region 1705 1716 N/A INTRINSIC
internal_repeat_1 1728 1785 6.57e-6 PROSPERO
low complexity region 1795 1815 N/A INTRINSIC
internal_repeat_1 1941 1996 6.57e-6 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,650,660 Y164* probably null Het
4932438A13Rik A G 3: 36,949,843 probably null Het
9130019O22Rik T C 7: 127,386,535 T95A unknown Het
Abce1 G A 8: 79,699,374 T258M probably benign Het
Actl7b G C 4: 56,740,693 P222A probably benign Het
Adam2 T C 14: 66,056,541 N279S probably benign Het
Adamts13 A G 2: 27,005,206 D1103G probably benign Het
Aff1 G A 5: 103,847,809 S1089N probably benign Het
Ahcyl2 T C 6: 29,768,556 S7P unknown Het
Anks1b A G 10: 90,260,846 probably null Het
Azin1 A C 15: 38,491,634 D359E probably damaging Het
Bahd1 A G 2: 118,916,310 T137A probably benign Het
C1qbp A G 11: 70,978,772 S162P probably damaging Het
C1rb A G 6: 124,580,484 M527V not run Het
Ccdc90b A G 7: 92,578,530 Y234C probably damaging Het
Cyp11b2 A T 15: 74,853,750 probably null Het
Dchs1 A G 7: 105,765,982 V665A probably damaging Het
Dhx8 T C 11: 101,764,797 S1119P probably damaging Het
Dnah6 T C 6: 73,092,168 D2512G probably damaging Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
E4f1 G T 17: 24,455,233 A19D unknown Het
Eftud2 T C 11: 102,848,012 D517G possibly damaging Het
Epha6 T A 16: 60,205,772 I436F possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ezh1 A G 11: 101,217,029 M74T probably benign Het
Fam71d C A 12: 78,715,014 Q151K probably damaging Het
Galnt14 T A 17: 73,504,921 K435M possibly damaging Het
Gde1 A T 7: 118,705,536 Y39N possibly damaging Het
Gldn G A 9: 54,338,593 R476Q probably benign Het
Gm32742 G T 9: 51,156,762 R307S probably benign Het
Gnao1 T G 8: 93,944,344 N150K Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gria4 A G 9: 4,464,315 M549T probably damaging Het
Grik3 C A 4: 125,623,635 D90E probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hspd1 T C 1: 55,080,337 E327G probably benign Het
Kif6 T C 17: 49,671,101 I107T probably damaging Het
Kmt2e C T 5: 23,501,765 T1442M not run Het
Lama3 C T 18: 12,500,493 H1561Y possibly damaging Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrrc63 C A 14: 75,084,969 W565L possibly damaging Het
Maats1 C A 16: 38,298,236 E734* probably null Het
Malrd1 A G 2: 15,925,192 N1503S unknown Het
Mcm7 C T 5: 138,169,724 V38I probably benign Het
Mphosph9 C T 5: 124,316,117 V106I probably benign Het
Mroh8 G T 2: 157,269,564 L157I possibly damaging Het
Mta2 T A 19: 8,945,836 S91T probably damaging Het
Muc5ac A T 7: 141,809,709 Q2252H unknown Het
Ndufs7 G T 10: 80,253,697 V59L probably benign Het
Nrxn2 T C 19: 6,531,961 L1642P probably damaging Het
Olfr1053 G A 2: 86,314,900 P129S probably damaging Het
Pbxip1 A T 3: 89,445,595 I183L probably benign Het
Peak1 A T 9: 56,241,207 L1085* probably null Het
Phf20l1 A G 15: 66,604,084 T189A probably benign Het
Poteg T A 8: 27,458,655 probably null Het
Proc G A 18: 32,134,778 probably null Het
Prr36 G A 8: 4,214,836 R277C unknown Het
Ptpn3 T C 4: 57,240,845 N257D probably damaging Het
Rnf5 C A 17: 34,601,664 V150L probably benign Het
Sbf2 T A 7: 110,378,067 Q666L possibly damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sipa1l2 A T 8: 125,419,272 V1681E probably benign Het
Slc15a5 A T 6: 138,079,786 L44Q probably damaging Het
Slc29a1 C A 17: 45,592,324 probably null Het
Slc5a8 G T 10: 88,904,960 V246F possibly damaging Het
Spint2 T C 7: 29,258,519 E154G probably damaging Het
Sycp1 A T 3: 102,913,433 S413T probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trio A T 15: 27,736,445 probably null Het
Unc13b A G 4: 43,170,102 Y310C unknown Het
Unc13b A G 4: 43,256,776 T1155A possibly damaging Het
Vmn2r79 A G 7: 87,003,384 probably null Het
Xpo7 T A 14: 70,671,670 S803C probably damaging Het
Other mutations in Ccdc88c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ccdc88c APN 12 100916803 missense probably benign 0.04
IGL02016:Ccdc88c APN 12 100941207 missense possibly damaging 0.63
IGL02031:Ccdc88c APN 12 100933311 missense probably damaging 0.98
IGL02133:Ccdc88c APN 12 100940090 missense probably damaging 1.00
IGL02427:Ccdc88c APN 12 100921592 missense probably damaging 1.00
IGL02494:Ccdc88c APN 12 100945475 missense probably benign
IGL02496:Ccdc88c APN 12 100953293 missense probably benign 0.05
IGL02549:Ccdc88c APN 12 100928932 missense probably benign 0.18
IGL02618:Ccdc88c APN 12 100913553 missense probably benign 0.28
IGL02626:Ccdc88c APN 12 100967800 unclassified probably benign
IGL03142:Ccdc88c APN 12 100947198 missense probably damaging 1.00
BB010:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
BB020:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R0127:Ccdc88c UTSW 12 100935740 missense possibly damaging 0.88
R0533:Ccdc88c UTSW 12 100954282 missense probably damaging 1.00
R0545:Ccdc88c UTSW 12 100947188 missense probably damaging 1.00
R0866:Ccdc88c UTSW 12 100913192 missense probably benign 0.01
R1230:Ccdc88c UTSW 12 100948488 missense probably benign 0.00
R1434:Ccdc88c UTSW 12 100939166 splice site probably benign
R1614:Ccdc88c UTSW 12 100912984 missense probably benign 0.00
R1644:Ccdc88c UTSW 12 100913474 missense probably damaging 0.98
R1712:Ccdc88c UTSW 12 100939025 missense probably benign 0.14
R2107:Ccdc88c UTSW 12 100921549 missense probably benign
R3612:Ccdc88c UTSW 12 100939073 missense probably damaging 0.99
R3724:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3737:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3743:Ccdc88c UTSW 12 100948584 missense probably damaging 1.00
R3772:Ccdc88c UTSW 12 100966100 unclassified probably benign
R3776:Ccdc88c UTSW 12 100947179 missense probably damaging 0.97
R3917:Ccdc88c UTSW 12 100941107 critical splice donor site probably null
R4034:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4035:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4110:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4113:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4270:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4271:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4520:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4521:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4522:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4523:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4524:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4717:Ccdc88c UTSW 12 100916666 missense probably benign 0.00
R4821:Ccdc88c UTSW 12 100938079 missense probably benign 0.00
R4823:Ccdc88c UTSW 12 100930543 missense probably damaging 1.00
R5090:Ccdc88c UTSW 12 100954180 missense probably damaging 1.00
R5510:Ccdc88c UTSW 12 100945031 missense probably damaging 1.00
R5514:Ccdc88c UTSW 12 100913439 missense probably damaging 1.00
R5903:Ccdc88c UTSW 12 100930542 missense probably damaging 1.00
R5999:Ccdc88c UTSW 12 100968354 missense probably damaging 1.00
R6131:Ccdc88c UTSW 12 100941128 missense probably damaging 1.00
R6164:Ccdc88c UTSW 12 100953383 missense probably damaging 0.98
R6971:Ccdc88c UTSW 12 100954227 missense probably damaging 1.00
R6998:Ccdc88c UTSW 12 100916852 missense probably damaging 0.96
R7031:Ccdc88c UTSW 12 100945064 missense probably damaging 1.00
R7240:Ccdc88c UTSW 12 100944939 missense probably benign 0.17
R7366:Ccdc88c UTSW 12 100944950 missense possibly damaging 0.89
R7674:Ccdc88c UTSW 12 100945232 missense probably benign 0.00
R7795:Ccdc88c UTSW 12 100923311 missense probably benign 0.32
R7933:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R7990:Ccdc88c UTSW 12 100967985 missense probably damaging 1.00
R8339:Ccdc88c UTSW 12 100941140 nonsense probably null
Z1176:Ccdc88c UTSW 12 100945770 missense possibly damaging 0.69
Z1177:Ccdc88c UTSW 12 100945155 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGACAGCCTTCACAGGAC -3'
(R):5'- ATTCAGTGACCAGTGTGGGG -3'

Sequencing Primer
(F):5'- ATGGGCAGCAGTTCTCAATC -3'
(R):5'- CCAGTGTGGGGATGAGCAC -3'
Posted On2019-10-24