Mutagenetix > Incidental Mutation

Incidental Mutation 'R7604:Adam2'

588192

Institutional Source

Beutler Lab

Gene Symbol

Adam2

Ensembl Gene

ENSMUSG00000022039

Gene Name

a disintegrin and metallopeptidase domain 2

Synonyms

fertilin beta, Ftnb, Ph30-beta

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7604 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66027329-66077733 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66056541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 279 (N279S)

Ref Sequence

ENSEMBL: ENSMUSP00000022618 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022618]

AlphaFold

Q60718

Predicted Effect

probably benign
Transcript: ENSMUST00000022618
AA Change: N279S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: N279S

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	17	147	2.1e-26	PFAM
Pfam:Reprolysin	184	381	7.1e-73	PFAM
DISIN	398	474	1.21e-27	SMART
ACR	475	612	6.96e-62	SMART
transmembrane domain	687	709	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	T	3: 146,650,660	Y164*	probably null	Het
4932438A13Rik	A	G	3: 36,949,843		probably null	Het
9130019O22Rik	T	C	7: 127,386,535	T95A	unknown	Het
Abce1	G	A	8: 79,699,374	T258M	probably benign	Het
Actl7b	G	C	4: 56,740,693	P222A	probably benign	Het
Adamts13	A	G	2: 27,005,206	D1103G	probably benign	Het
Aff1	G	A	5: 103,847,809	S1089N	probably benign	Het
Ahcyl2	T	C	6: 29,768,556	S7P	unknown	Het
Anks1b	A	G	10: 90,260,846		probably null	Het
Azin1	A	C	15: 38,491,634	D359E	probably damaging	Het
Bahd1	A	G	2: 118,916,310	T137A	probably benign	Het
C1qbp	A	G	11: 70,978,772	S162P	probably damaging	Het
C1rb	A	G	6: 124,580,484	M527V	not run	Het
Ccdc88c	A	T	12: 100,930,547	D1381E	probably damaging	Het
Ccdc90b	A	G	7: 92,578,530	Y234C	probably damaging	Het
Cyp11b2	A	T	15: 74,853,750		probably null	Het
Dchs1	A	G	7: 105,765,982	V665A	probably damaging	Het
Dhx8	T	C	11: 101,764,797	S1119P	probably damaging	Het
Dnah6	T	C	6: 73,092,168	D2512G	probably damaging	Het
Dnah8	T	C	17: 30,813,095	Y4130H	probably damaging	Het
E4f1	G	T	17: 24,455,233	A19D	unknown	Het
Eftud2	T	C	11: 102,848,012	D517G	possibly damaging	Het
Epha6	T	A	16: 60,205,772	I436F	possibly damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ezh1	A	G	11: 101,217,029	M74T	probably benign	Het
Fam71d	C	A	12: 78,715,014	Q151K	probably damaging	Het
Galnt14	T	A	17: 73,504,921	K435M	possibly damaging	Het
Gde1	A	T	7: 118,705,536	Y39N	possibly damaging	Het
Gldn	G	A	9: 54,338,593	R476Q	probably benign	Het
Gm32742	G	T	9: 51,156,762	R307S	probably benign	Het
Gnao1	T	G	8: 93,944,344	N150K		Het
Gpr135	A	T	12: 72,069,867	D375E	possibly damaging	Het
Gria4	A	G	9: 4,464,315	M549T	probably damaging	Het
Grik3	C	A	4: 125,623,635	D90E	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Hspd1	T	C	1: 55,080,337	E327G	probably benign	Het
Kif6	T	C	17: 49,671,101	I107T	probably damaging	Het
Kmt2e	C	T	5: 23,501,765	T1442M	not run	Het
Lama3	C	T	18: 12,500,493	H1561Y	possibly damaging	Het
Lpcat3	A	G	6: 124,702,530	N331S	probably benign	Het
Lrrc63	C	A	14: 75,084,969	W565L	possibly damaging	Het
Maats1	C	A	16: 38,298,236	E734*	probably null	Het
Malrd1	A	G	2: 15,925,192	N1503S	unknown	Het
Mcm7	C	T	5: 138,169,724	V38I	probably benign	Het
Mphosph9	C	T	5: 124,316,117	V106I	probably benign	Het
Mroh8	G	T	2: 157,269,564	L157I	possibly damaging	Het
Mta2	T	A	19: 8,945,836	S91T	probably damaging	Het
Muc5ac	A	T	7: 141,809,709	Q2252H	unknown	Het
Ndufs7	G	T	10: 80,253,697	V59L	probably benign	Het
Nrxn2	T	C	19: 6,531,961	L1642P	probably damaging	Het
Olfr1053	G	A	2: 86,314,900	P129S	probably damaging	Het
Pbxip1	A	T	3: 89,445,595	I183L	probably benign	Het
Peak1	A	T	9: 56,241,207	L1085*	probably null	Het
Phf20l1	A	G	15: 66,604,084	T189A	probably benign	Het
Poteg	T	A	8: 27,458,655		probably null	Het
Proc	G	A	18: 32,134,778		probably null	Het
Prr36	G	A	8: 4,214,836	R277C	unknown	Het
Ptpn3	T	C	4: 57,240,845	N257D	probably damaging	Het
Rnf5	C	A	17: 34,601,664	V150L	probably benign	Het
Sbf2	T	A	7: 110,378,067	Q666L	possibly damaging	Het
Sdk2	C	T	11: 113,829,969	R1378H	possibly damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sipa1l2	A	T	8: 125,419,272	V1681E	probably benign	Het
Slc15a5	A	T	6: 138,079,786	L44Q	probably damaging	Het
Slc29a1	C	A	17: 45,592,324		probably null	Het
Slc5a8	G	T	10: 88,904,960	V246F	possibly damaging	Het
Spint2	T	C	7: 29,258,519	E154G	probably damaging	Het
Sycp1	A	T	3: 102,913,433	S413T	probably damaging	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Trio	A	T	15: 27,736,445		probably null	Het
Unc13b	A	G	4: 43,170,102	Y310C	unknown	Het
Unc13b	A	G	4: 43,256,776	T1155A	possibly damaging	Het
Vmn2r79	A	G	7: 87,003,384		probably null	Het
Xpo7	T	A	14: 70,671,670	S803C	probably damaging	Het

Other mutations in Adam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Adam2	APN	14	66074049	critical splice donor site	probably null
IGL00980:Adam2	APN	14	66056528	nonsense	probably null
IGL01404:Adam2	APN	14	66077210	critical splice donor site	probably null
IGL01901:Adam2	APN	14	66035229	splice site	probably benign
IGL02687:Adam2	APN	14	66069190	missense	probably damaging	1.00
IGL02692:Adam2	APN	14	66074087	missense	probably damaging	1.00
IGL02695:Adam2	APN	14	66050480	missense	probably benign	0.01
IGL02798:Adam2	APN	14	66040275	missense	probably damaging	1.00
IGL03217:Adam2	APN	14	66034813	missense	possibly damaging	0.85
IGL03256:Adam2	APN	14	66053831	missense	probably benign	0.03
aldrin	UTSW	14	66057637	missense	probably damaging	1.00
armstrong	UTSW	14	66037557	missense	possibly damaging	0.95
sacher	UTSW	14	66068558	missense	probably damaging	1.00
zuker	UTSW	14	66059912	missense	probably benign	0.14
R0092:Adam2	UTSW	14	66053887	missense	probably damaging	1.00
R0281:Adam2	UTSW	14	66037606	missense	probably benign	0.20
R0636:Adam2	UTSW	14	66034816	missense	probably benign	0.03
R0690:Adam2	UTSW	14	66057646	missense	probably damaging	1.00
R0727:Adam2	UTSW	14	66029731	missense	probably damaging	1.00
R1477:Adam2	UTSW	14	66077700	missense	possibly damaging	0.96
R1634:Adam2	UTSW	14	66057731	missense	probably damaging	1.00
R1652:Adam2	UTSW	14	66077251	missense	probably benign	0.41
R1717:Adam2	UTSW	14	66068558	missense	probably damaging	1.00
R1868:Adam2	UTSW	14	66077658	missense	probably damaging	0.99
R1915:Adam2	UTSW	14	66037557	missense	possibly damaging	0.95
R3748:Adam2	UTSW	14	66059912	missense	probably benign	0.14
R3953:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R3954:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R3955:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R3956:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R3957:Adam2	UTSW	14	66057610	missense	probably damaging	1.00
R4091:Adam2	UTSW	14	66029723	missense	probably damaging	0.97
R5673:Adam2	UTSW	14	66069232	missense	probably benign	0.03
R5761:Adam2	UTSW	14	66046146	missense	probably damaging	1.00
R6187:Adam2	UTSW	14	66068619	missense	possibly damaging	0.89
R6499:Adam2	UTSW	14	66058790	missense	probably damaging	1.00
R6730:Adam2	UTSW	14	66037576	missense	possibly damaging	0.83
R6829:Adam2	UTSW	14	66027997	critical splice donor site	probably null
R7023:Adam2	UTSW	14	66043056	missense	probably benign	0.22
R7168:Adam2	UTSW	14	66058792	missense	possibly damaging	0.89
R7228:Adam2	UTSW	14	66053912	nonsense	probably null
R7293:Adam2	UTSW	14	66035185	missense	probably benign	0.29
R7765:Adam2	UTSW	14	66059896	missense	probably damaging	1.00
R8380:Adam2	UTSW	14	66037557	missense	probably benign	0.01
R8532:Adam2	UTSW	14	66056521	missense	probably damaging	1.00
R8728:Adam2	UTSW	14	66057637	missense	probably damaging	1.00
R8744:Adam2	UTSW	14	66034716	critical splice donor site	probably null
R9282:Adam2	UTSW	14	66029789	missense	probably benign	0.00
R9307:Adam2	UTSW	14	66050472	missense	probably damaging	1.00
R9560:Adam2	UTSW	14	66037653	missense	not run
R9574:Adam2	UTSW	14	66037622	missense	not run
X0061:Adam2	UTSW	14	66053905	missense	possibly damaging	0.66
Z1177:Adam2	UTSW	14	66056521	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAGCCTGTTATTCACTAAAG -3'
(R):5'- TTGCAAAGGGGACACAACCTAC -3'

Sequencing Primer
(F):5'- CAAGAGGGCACTGAGTCTAGTCTC -3'
(R):5'- ACCTACAAGTTGAGAACTGCTG -3'

Posted On

2019-10-24