Incidental Mutation 'R7604:Adam2'
ID 588192
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Name a disintegrin and metallopeptidase domain 2
Synonyms fertilin beta, Ph30-beta, Ftnb
MMRRC Submission 045644-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7604 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 66264778-66315182 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66293990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 279 (N279S)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
AlphaFold Q60718
Predicted Effect probably benign
Transcript: ENSMUST00000022618
AA Change: N279S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: N279S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,356,415 (GRCm39) Y164* probably null Het
Abce1 G A 8: 80,426,003 (GRCm39) T258M probably benign Het
Actl7b G C 4: 56,740,693 (GRCm39) P222A probably benign Het
Adamts13 A G 2: 26,895,218 (GRCm39) D1103G probably benign Het
Aff1 G A 5: 103,995,675 (GRCm39) S1089N probably benign Het
Ahcyl2 T C 6: 29,768,555 (GRCm39) S7P unknown Het
Anks1b A G 10: 90,096,708 (GRCm39) probably null Het
Azin1 A C 15: 38,491,878 (GRCm39) D359E probably damaging Het
Bahd1 A G 2: 118,746,791 (GRCm39) T137A probably benign Het
Bltp1 A G 3: 37,003,992 (GRCm39) probably null Het
C1qbp A G 11: 70,869,598 (GRCm39) S162P probably damaging Het
C1rb A G 6: 124,557,443 (GRCm39) M527V not run Het
Ccdc88c A T 12: 100,896,806 (GRCm39) D1381E probably damaging Het
Ccdc90b A G 7: 92,227,738 (GRCm39) Y234C probably damaging Het
Cfap91 C A 16: 38,118,598 (GRCm39) E734* probably null Het
Cyp11b2 A T 15: 74,725,599 (GRCm39) probably null Het
Dchs1 A G 7: 105,415,189 (GRCm39) V665A probably damaging Het
Dhx8 T C 11: 101,655,623 (GRCm39) S1119P probably damaging Het
Dnah6 T C 6: 73,069,151 (GRCm39) D2512G probably damaging Het
Dnah8 T C 17: 31,032,069 (GRCm39) Y4130H probably damaging Het
E4f1 G T 17: 24,674,207 (GRCm39) A19D unknown Het
Eftud2 T C 11: 102,738,838 (GRCm39) D517G possibly damaging Het
Epha6 T A 16: 60,026,135 (GRCm39) I436F possibly damaging Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Ezh1 A G 11: 101,107,855 (GRCm39) M74T probably benign Het
Galnt14 T A 17: 73,811,916 (GRCm39) K435M possibly damaging Het
Garin2 C A 12: 78,761,788 (GRCm39) Q151K probably damaging Het
Gde1 A T 7: 118,304,759 (GRCm39) Y39N possibly damaging Het
Gldn G A 9: 54,245,877 (GRCm39) R476Q probably benign Het
Gm32742 G T 9: 51,068,062 (GRCm39) R307S probably benign Het
Gnao1 T G 8: 94,670,972 (GRCm39) N150K Het
Gpr135 A T 12: 72,116,641 (GRCm39) D375E possibly damaging Het
Gria4 A G 9: 4,464,315 (GRCm39) M549T probably damaging Het
Grik3 C A 4: 125,517,428 (GRCm39) D90E probably damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Hspd1 T C 1: 55,119,496 (GRCm39) E327G probably benign Het
Kif6 T C 17: 49,978,129 (GRCm39) I107T probably damaging Het
Kmt2e C T 5: 23,706,763 (GRCm39) T1442M not run Het
Lama3 C T 18: 12,633,550 (GRCm39) H1561Y possibly damaging Het
Lpcat3 A G 6: 124,679,493 (GRCm39) N331S probably benign Het
Lrrc63 C A 14: 75,322,409 (GRCm39) W565L possibly damaging Het
Malrd1 A G 2: 15,930,003 (GRCm39) N1503S unknown Het
Mcm7 C T 5: 138,167,986 (GRCm39) V38I probably benign Het
Mphosph9 C T 5: 124,454,180 (GRCm39) V106I probably benign Het
Mroh8 G T 2: 157,111,484 (GRCm39) L157I possibly damaging Het
Mta2 T A 19: 8,923,200 (GRCm39) S91T probably damaging Het
Muc5ac A T 7: 141,363,446 (GRCm39) Q2252H unknown Het
Ndufs7 G T 10: 80,089,531 (GRCm39) V59L probably benign Het
Nrxn2 T C 19: 6,581,991 (GRCm39) L1642P probably damaging Het
Or8k21 G A 2: 86,145,244 (GRCm39) P129S probably damaging Het
Pbxip1 A T 3: 89,352,902 (GRCm39) I183L probably benign Het
Peak1 A T 9: 56,148,491 (GRCm39) L1085* probably null Het
Phf20l1 A G 15: 66,475,933 (GRCm39) T189A probably benign Het
Poteg T A 8: 27,948,683 (GRCm39) probably null Het
Proc G A 18: 32,267,831 (GRCm39) probably null Het
Prr36 G A 8: 4,264,836 (GRCm39) R277C unknown Het
Ptpn3 T C 4: 57,240,845 (GRCm39) N257D probably damaging Het
Rnf5 C A 17: 34,820,638 (GRCm39) V150L probably benign Het
Sbf2 T A 7: 109,977,274 (GRCm39) Q666L possibly damaging Het
Sdk2 C T 11: 113,720,795 (GRCm39) R1378H possibly damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sipa1l2 A T 8: 126,146,011 (GRCm39) V1681E probably benign Het
Slc15a5 A T 6: 138,056,784 (GRCm39) L44Q probably damaging Het
Slc29a1 C A 17: 45,903,250 (GRCm39) probably null Het
Slc5a8 G T 10: 88,740,822 (GRCm39) V246F possibly damaging Het
Spint2 T C 7: 28,957,944 (GRCm39) E154G probably damaging Het
Sycp1 A T 3: 102,820,749 (GRCm39) S413T probably damaging Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Trio A T 15: 27,736,531 (GRCm39) probably null Het
Unc13b A G 4: 43,170,102 (GRCm39) Y310C unknown Het
Unc13b A G 4: 43,256,776 (GRCm39) T1155A possibly damaging Het
Vmn2r79 A G 7: 86,652,592 (GRCm39) probably null Het
Xpo7 T A 14: 70,909,110 (GRCm39) S803C probably damaging Het
Zfp747l1 T C 7: 126,985,707 (GRCm39) T95A unknown Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66,311,498 (GRCm39) critical splice donor site probably null
IGL00980:Adam2 APN 14 66,293,977 (GRCm39) nonsense probably null
IGL01404:Adam2 APN 14 66,314,659 (GRCm39) critical splice donor site probably null
IGL01901:Adam2 APN 14 66,272,678 (GRCm39) splice site probably benign
IGL02687:Adam2 APN 14 66,306,639 (GRCm39) missense probably damaging 1.00
IGL02692:Adam2 APN 14 66,311,536 (GRCm39) missense probably damaging 1.00
IGL02695:Adam2 APN 14 66,287,929 (GRCm39) missense probably benign 0.01
IGL02798:Adam2 APN 14 66,277,724 (GRCm39) missense probably damaging 1.00
IGL03217:Adam2 APN 14 66,272,262 (GRCm39) missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66,291,280 (GRCm39) missense probably benign 0.03
aldrin UTSW 14 66,295,086 (GRCm39) missense probably damaging 1.00
armstrong UTSW 14 66,275,006 (GRCm39) missense possibly damaging 0.95
sacher UTSW 14 66,306,007 (GRCm39) missense probably damaging 1.00
zuker UTSW 14 66,297,361 (GRCm39) missense probably benign 0.14
R0092:Adam2 UTSW 14 66,291,336 (GRCm39) missense probably damaging 1.00
R0281:Adam2 UTSW 14 66,275,055 (GRCm39) missense probably benign 0.20
R0636:Adam2 UTSW 14 66,272,265 (GRCm39) missense probably benign 0.03
R0690:Adam2 UTSW 14 66,295,095 (GRCm39) missense probably damaging 1.00
R0727:Adam2 UTSW 14 66,267,180 (GRCm39) missense probably damaging 1.00
R1477:Adam2 UTSW 14 66,315,149 (GRCm39) missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66,295,180 (GRCm39) missense probably damaging 1.00
R1652:Adam2 UTSW 14 66,314,700 (GRCm39) missense probably benign 0.41
R1717:Adam2 UTSW 14 66,306,007 (GRCm39) missense probably damaging 1.00
R1868:Adam2 UTSW 14 66,315,107 (GRCm39) missense probably damaging 0.99
R1915:Adam2 UTSW 14 66,275,006 (GRCm39) missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66,297,361 (GRCm39) missense probably benign 0.14
R3953:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3954:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3955:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3956:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3957:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R4091:Adam2 UTSW 14 66,267,172 (GRCm39) missense probably damaging 0.97
R5673:Adam2 UTSW 14 66,306,681 (GRCm39) missense probably benign 0.03
R5761:Adam2 UTSW 14 66,283,595 (GRCm39) missense probably damaging 1.00
R6187:Adam2 UTSW 14 66,306,068 (GRCm39) missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66,296,239 (GRCm39) missense probably damaging 1.00
R6730:Adam2 UTSW 14 66,275,025 (GRCm39) missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66,265,446 (GRCm39) critical splice donor site probably null
R7023:Adam2 UTSW 14 66,280,505 (GRCm39) missense probably benign 0.22
R7168:Adam2 UTSW 14 66,296,241 (GRCm39) missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66,291,361 (GRCm39) nonsense probably null
R7293:Adam2 UTSW 14 66,272,634 (GRCm39) missense probably benign 0.29
R7765:Adam2 UTSW 14 66,297,345 (GRCm39) missense probably damaging 1.00
R8380:Adam2 UTSW 14 66,275,006 (GRCm39) missense probably benign 0.01
R8532:Adam2 UTSW 14 66,293,970 (GRCm39) missense probably damaging 1.00
R8728:Adam2 UTSW 14 66,295,086 (GRCm39) missense probably damaging 1.00
R8744:Adam2 UTSW 14 66,272,165 (GRCm39) critical splice donor site probably null
R9282:Adam2 UTSW 14 66,267,238 (GRCm39) missense probably benign 0.00
R9307:Adam2 UTSW 14 66,287,921 (GRCm39) missense probably damaging 1.00
R9560:Adam2 UTSW 14 66,275,102 (GRCm39) missense probably benign 0.12
R9574:Adam2 UTSW 14 66,275,071 (GRCm39) missense probably benign 0.10
R9608:Adam2 UTSW 14 66,291,279 (GRCm39) missense probably null 0.05
X0061:Adam2 UTSW 14 66,291,354 (GRCm39) missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66,293,970 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGCCTGTTATTCACTAAAG -3'
(R):5'- TTGCAAAGGGGACACAACCTAC -3'

Sequencing Primer
(F):5'- CAAGAGGGCACTGAGTCTAGTCTC -3'
(R):5'- ACCTACAAGTTGAGAACTGCTG -3'
Posted On 2019-10-24