Incidental Mutation 'R7605:Dnah7c'
ID 588209
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R7605 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46632310 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1620 (R1620C)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000189749
AA Change: R1620C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: R1620C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,918,164 L610P probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Ep300 A C 15: 81,621,152 M658L unknown Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ephb2 A T 4: 136,771,108 V220E probably damaging Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grik4 A G 9: 42,688,071 C37R probably damaging Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr170 T C 16: 19,606,272 Y131C probably damaging Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Robo1 C A 16: 73,024,301 R1310S probably benign Het
Scnm1 A T 3: 95,132,875 N115K probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Topbp1 A T 9: 103,332,706 T851S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGGTGAAATTACCAAAGCCAGATTAC -3'
(R):5'- TCATCTGTGTTGGACTCATTGC -3'

Sequencing Primer
(F):5'- GCCAGATTACAATGATCTGCTGGC -3'
(R):5'- GGACTCATTGCTTGTTTCATTTTGC -3'
Posted On 2019-10-24