Incidental Mutation 'R7605:Scnm1'
ID588217
Institutional Source Beutler Lab
Gene Symbol Scnm1
Ensembl Gene ENSMUSG00000092607
Gene Namesodium channel modifier 1
SynonymsScnm1-ps, 3110001I17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027013; MGI: 1341284; Ensembl: ENSMUST00000145135

Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R7605 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95129536-95134011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95132875 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 115 (N115K)
Ref Sequence ENSEMBL: ENSMUSP00000134337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005769] [ENSMUST00000066386] [ENSMUST00000107227] [ENSMUST00000172572] [ENSMUST00000173462]
Predicted Effect probably benign
Transcript: ENSMUST00000005769
SMART Domains Protein: ENSMUSP00000005769
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 4 143 2.7e-62 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066386
SMART Domains Protein: ENSMUSP00000067811
Gene: ENSMUSG00000053769

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LysM 41 85 2.58e-7 SMART
low complexity region 100 108 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107227
SMART Domains Protein: ENSMUSP00000102846
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 4.4e-72 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172572
AA Change: N115K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134337
Gene: ENSMUSG00000092607
AA Change: N115K

DomainStartEndE-ValueType
Pfam:zf-SCNM1 44 70 7.6e-19 PFAM
low complexity region 133 148 N/A INTRINSIC
low complexity region 172 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173462
AA Change: N115K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133769
Gene: ENSMUSG00000092607
AA Change: N115K

DomainStartEndE-ValueType
Blast:ZnF_C2H2 42 68 2e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Mutations in the voltage-gated sodium channel gene Scn8a lead to neurological problems in mice. For one particular mutation, Scn8amedJ, mice live to adulthood but have tremors and muscle weakness, among other problems, in all strains except those derived from C57BL6 mice. In these strains, the product of the Scnm1 gene (229 aa) partially overcomes the effects of the Scn8amedJ mutation. However, in C57BL6-derived mice, a one nt change in the penultimate exon creates a premature stop codon, truncating the Scnm1 protein at 186 aa. This truncated protein lacks the ability to overcome the effects of the Scn8amedJ mutation, and these mice suffer paralysis and juvenile death. [provided by RefSeq, Jul 2009]
PHENOTYPE: The Scnm1 locus influences the severity of the Scn8amed-J phenotype. Mice carrying the recesive susceptibility allele of the modifier are paralyzed and do not survive beyond 1 month. Mice carryimg the resistant allele display progressive dystonia with ataxia and live more than 1.5 years. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,918,164 L610P probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dnah7c C T 1: 46,632,310 R1620C probably damaging Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Ep300 A C 15: 81,621,152 M658L unknown Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ephb2 A T 4: 136,771,108 V220E probably damaging Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grik4 A G 9: 42,688,071 C37R probably damaging Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr170 T C 16: 19,606,272 Y131C probably damaging Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Robo1 C A 16: 73,024,301 R1310S probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Topbp1 A T 9: 103,332,706 T851S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Scnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02964:Scnm1 APN 3 95133037 missense probably benign 0.07
R1917:Scnm1 UTSW 3 95130273 missense possibly damaging 0.59
R5538:Scnm1 UTSW 3 95129755 utr 3 prime probably benign
R5888:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R5955:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R5956:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R6082:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R6086:Scnm1 UTSW 3 95130285 missense probably benign 0.06
R7182:Scnm1 UTSW 3 95133854 missense possibly damaging 0.60
R7206:Scnm1 UTSW 3 95133894 start codon destroyed probably null 1.00
R8517:Scnm1 UTSW 3 95132823 critical splice donor site probably null
Z1176:Scnm1 UTSW 3 95130341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGGAAGAGCAGTCAGTG -3'
(R):5'- TCCAAGACAGCAGAACGAATTG -3'

Sequencing Primer
(F):5'- CAGTCAGTGCTCTTAACTGCTGAG -3'
(R):5'- CCAAGACAGCAGAACGAATTGAAGAC -3'
Posted On2019-10-24