Mutagenetix > Incidental Mutation

Incidental Mutation 'R7605:Col24a1'

588221

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7605 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 145538687 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 1572 (Y1572F)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029848
AA Change: Y1572F

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: Y1572F

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	G	12: 118,918,164	L610P	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Asphd2	A	G	5: 112,391,941	W9R	probably damaging	Het
Blvrb	T	A	7: 27,465,793	H179Q	probably damaging	Het
Capn13	A	T	17: 73,345,137		probably null	Het
Casp6	A	T	3: 129,912,163	M160L	probably benign	Het
Chordc1	A	G	9: 18,304,372	E140G	probably benign	Het
Cul9	A	G	17: 46,541,732	S235P	probably damaging	Het
Cyp2u1	A	T	3: 131,297,953	M306K	probably damaging	Het
Dhx33	A	G	11: 70,999,473	L240P	probably damaging	Het
Dna2	T	A	10: 62,960,275	D494E	probably benign	Het
Dnah7c	C	T	1: 46,632,310	R1620C	probably damaging	Het
Dpp8	G	A	9: 65,054,958	V427M	probably benign	Het
Dpt	G	A	1: 164,796,831	G34S	unknown	Het
Emb	T	A	13: 117,264,510	N198K	probably damaging	Het
Entpd5	T	G	12: 84,396,708	H62P	probably damaging	Het
Ep300	A	C	15: 81,621,152	M658L	unknown	Het
Epb41l4a	T	A	18: 33,797,451	D651V	probably damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ephb2	A	T	4: 136,771,108	V220E	probably damaging	Het
Fam187a	T	A	11: 102,886,048	L226H	possibly damaging	Het
Fbxo42	G	A	4: 141,199,818	A470T	probably benign	Het
Fcgrt	C	T	7: 45,095,251	W264*	probably null	Het
Flt3	A	C	5: 147,349,576	H733Q	probably benign	Het
Gabrr2	A	G	4: 33,082,560	D228G	probably damaging	Het
Gars	T	C	6: 55,077,750	S681P	probably damaging	Het
Gata2	T	C	6: 88,200,408	V140A	possibly damaging	Het
Gm8232	A	T	14: 44,434,927	N100I		Het
Grik4	A	G	9: 42,688,071	C37R	probably damaging	Het
Grm8	T	C	6: 27,618,679	E388G	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igsf9b	C	T	9: 27,323,312	T491I	probably damaging	Het
Impa1	C	T	3: 10,324,087	V105I	probably damaging	Het
Inf2	A	G	12: 112,601,337	T134A	probably damaging	Het
Itgb4	T	A	11: 116,006,476	V1521E	probably benign	Het
Iws1	T	A	18: 32,089,487	D623E	probably benign	Het
Lhfpl5	T	C	17: 28,576,331	S111P	possibly damaging	Het
Lyzl1	T	C	18: 4,169,244	C83R	probably damaging	Het
Madd	G	A	2: 91,169,710	T617M	possibly damaging	Het
Magi2	A	G	5: 20,228,385	T163A	probably damaging	Het
Mdn1	C	A	4: 32,694,599	H1107Q	probably damaging	Het
Mfsd14b	A	T	13: 65,066,777	Y454N	probably benign	Het
Mrgprb3	T	A	7: 48,643,114	I230F	probably benign	Het
Mroh2b	C	T	15: 4,945,023	L1162F	probably damaging	Het
Olfr1019	A	G	2: 85,841,039	F251L	probably benign	Het
Olfr170	T	C	16: 19,606,272	Y131C	probably damaging	Het
Olfr266	G	T	3: 106,822,021	H179Q	probably damaging	Het
Olfr311	A	G	11: 58,841,500	I129V	probably benign	Het
Olfr560	C	T	7: 102,753,745	M61I	probably benign	Het
Olfr631	T	C	7: 103,928,868	L15P	probably damaging	Het
Pclo	T	C	5: 14,679,036	L2636P	unknown	Het
Pfkm	G	A	15: 98,121,310	A181T	probably damaging	Het
Pik3r1	C	T	13: 101,702,838	A169T	probably benign	Het
R3hdml	T	A	2: 163,495,768	M114K	probably damaging	Het
Robo1	C	A	16: 73,024,301	R1310S	probably benign	Het
Scnm1	A	T	3: 95,132,875	N115K	probably benign	Het
Sfn	A	G	4: 133,601,237	V178A	probably damaging	Het
Shank2	C	T	7: 144,091,779	T366I	possibly damaging	Het
Siah1a	T	C	8: 86,725,325	D177G	probably damaging	Het
Slc37a2	A	C	9: 37,237,328	I286S	possibly damaging	Het
Smarce1	T	C	11: 99,228,292	T12A	probably benign	Het
Spata31d1c	T	A	13: 65,035,840	S399T	probably benign	Het
Specc1	A	G	11: 62,211,680	S942G	possibly damaging	Het
Syt13	T	C	2: 92,943,133	F164S	probably benign	Het
Topbp1	A	T	9: 103,332,706	T851S	probably benign	Het
Ttn	A	T	2: 76,969,671	S398T	unknown	Het
Vmn1r12	T	C	6: 57,159,536	V206A	probably damaging	Het
Vmn1r224	G	A	17: 20,419,959	W266*	probably null	Het
Vmn2r68	T	C	7: 85,233,908	D212G	probably benign	Het
Vps13b	G	T	15: 35,770,646	K2078N	probably damaging	Het
Zfp251	A	C	15: 76,854,357	F179V	possibly damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCAGATTGTTATCAGGATCTTC -3'
(R):5'- GCACAGAGTCGAGTCTTTTCAC -3'

Sequencing Primer
(F):5'- GACCTTAATCAGCCACAG -3'
(R):5'- GAGTCGAGTCTTTTCACAAGTATATC -3'

Posted On

2019-10-24