Incidental Mutation 'R7605:Ephb2'
ID588227
Institutional Source Beutler Lab
Gene Symbol Ephb2
Ensembl Gene ENSMUSG00000028664
Gene NameEph receptor B2
SynonymsErk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R7605 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location136647539-136835988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136771108 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 220 (V220E)
Ref Sequence ENSEMBL: ENSMUSP00000101471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]
Predicted Effect probably damaging
Transcript: ENSMUST00000059287
AA Change: V220E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: V220E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 261 304 8.1e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 518 1.23e-10 SMART
Pfam:EphA2_TM 545 619 6e-25 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105845
AA Change: V220E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: V220E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 618 2.1e-30 PFAM
TyrKc 621 880 1.34e-138 SMART
SAM 910 977 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105846
AA Change: V220E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: V220E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 619 1e-30 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,918,164 L610P probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dnah7c C T 1: 46,632,310 R1620C probably damaging Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Ep300 A C 15: 81,621,152 M658L unknown Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grik4 A G 9: 42,688,071 C37R probably damaging Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr170 T C 16: 19,606,272 Y131C probably damaging Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Robo1 C A 16: 73,024,301 R1310S probably benign Het
Scnm1 A T 3: 95,132,875 N115K probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Topbp1 A T 9: 103,332,706 T851S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Ephb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ephb2 APN 4 136657484 missense probably damaging 0.96
IGL00963:Ephb2 APN 4 136658951 missense probably benign 0.04
IGL01111:Ephb2 APN 4 136657410 missense probably benign 0.01
IGL01462:Ephb2 APN 4 136771370 missense possibly damaging 0.61
IGL01863:Ephb2 APN 4 136659777 missense probably benign 0.03
IGL02149:Ephb2 APN 4 136693914 missense probably damaging 1.00
IGL02232:Ephb2 APN 4 136657451 missense probably damaging 0.97
IGL02269:Ephb2 APN 4 136771049 missense possibly damaging 0.66
IGL02828:Ephb2 APN 4 136771150 missense probably benign 0.09
IGL03109:Ephb2 APN 4 136771544 missense probably damaging 1.00
IGL03284:Ephb2 APN 4 136661516 missense probably damaging 0.96
PIT4453001:Ephb2 UTSW 4 136660810 missense probably benign 0.00
R0004:Ephb2 UTSW 4 136657524 missense probably damaging 1.00
R0121:Ephb2 UTSW 4 136771057 missense probably damaging 0.99
R0539:Ephb2 UTSW 4 136655976 missense probably damaging 1.00
R0614:Ephb2 UTSW 4 136673365 missense probably benign 0.00
R0988:Ephb2 UTSW 4 136659708 missense possibly damaging 0.59
R1471:Ephb2 UTSW 4 136658951 missense probably benign 0.04
R1473:Ephb2 UTSW 4 136694058 missense possibly damaging 0.83
R1546:Ephb2 UTSW 4 136771009 missense probably damaging 0.99
R1639:Ephb2 UTSW 4 136693905 missense probably benign 0.10
R1725:Ephb2 UTSW 4 136659778 nonsense probably null
R1779:Ephb2 UTSW 4 136693825 missense possibly damaging 0.64
R1818:Ephb2 UTSW 4 136655336 missense probably benign 0.02
R2099:Ephb2 UTSW 4 136660755 missense probably damaging 1.00
R2916:Ephb2 UTSW 4 136683945 missense probably damaging 0.99
R3885:Ephb2 UTSW 4 136771034 missense probably damaging 1.00
R4572:Ephb2 UTSW 4 136655940 missense probably damaging 1.00
R4709:Ephb2 UTSW 4 136696052 missense probably damaging 1.00
R4893:Ephb2 UTSW 4 136659753 missense probably damaging 0.99
R4981:Ephb2 UTSW 4 136696010 missense probably benign 0.09
R4992:Ephb2 UTSW 4 136660839 missense probably damaging 1.00
R5004:Ephb2 UTSW 4 136659699 missense possibly damaging 0.77
R5307:Ephb2 UTSW 4 136693787 missense possibly damaging 0.89
R5370:Ephb2 UTSW 4 136771570 missense probably benign 0.00
R5561:Ephb2 UTSW 4 136661406 missense probably damaging 1.00
R5643:Ephb2 UTSW 4 136771612 missense probably damaging 0.99
R5826:Ephb2 UTSW 4 136660737 missense probably damaging 1.00
R5858:Ephb2 UTSW 4 136672445 missense probably benign
R5867:Ephb2 UTSW 4 136675422 missense possibly damaging 0.81
R5990:Ephb2 UTSW 4 136696055 missense probably benign 0.03
R6000:Ephb2 UTSW 4 136684030 missense possibly damaging 0.76
R6156:Ephb2 UTSW 4 136661505 missense probably benign 0.44
R6413:Ephb2 UTSW 4 136771122 missense probably benign 0.08
R6577:Ephb2 UTSW 4 136657550 missense probably damaging 0.99
R6633:Ephb2 UTSW 4 136683996 missense probably benign 0.07
R6720:Ephb2 UTSW 4 136657502 missense probably damaging 0.99
R6795:Ephb2 UTSW 4 136673335 missense possibly damaging 0.88
R7235:Ephb2 UTSW 4 136693828 missense probably damaging 1.00
R7260:Ephb2 UTSW 4 136771574 missense probably damaging 0.96
R7328:Ephb2 UTSW 4 136658934 critical splice donor site probably null
R7404:Ephb2 UTSW 4 136771213 missense probably damaging 1.00
R7466:Ephb2 UTSW 4 136659065 missense probably damaging 1.00
R7524:Ephb2 UTSW 4 136659709 missense probably damaging 1.00
R7611:Ephb2 UTSW 4 136660901 critical splice acceptor site probably null
R7777:Ephb2 UTSW 4 136771636 missense possibly damaging 0.92
R7889:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
R7972:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGCAGCATCACCATACATCTG -3'
(R):5'- TGGCCGCGTCATGAAAATC -3'

Sequencing Primer
(F):5'- GCATCACCATACATCTGCAGGG -3'
(R):5'- TCATGAAAATCAACACTGAGGTGC -3'
Posted On2019-10-24