Mutagenetix > Incidental Mutation

Incidental Mutation 'R7605:Vmn2r68'

588240

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R7605 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85233908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 212 (D212G)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061074
AA Change: D212G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: D212G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	G	12: 118,918,164	L610P	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Asphd2	A	G	5: 112,391,941	W9R	probably damaging	Het
Blvrb	T	A	7: 27,465,793	H179Q	probably damaging	Het
Capn13	A	T	17: 73,345,137		probably null	Het
Casp6	A	T	3: 129,912,163	M160L	probably benign	Het
Chordc1	A	G	9: 18,304,372	E140G	probably benign	Het
Col24a1	A	T	3: 145,538,687	Y1572F	possibly damaging	Het
Cul9	A	G	17: 46,541,732	S235P	probably damaging	Het
Cyp2u1	A	T	3: 131,297,953	M306K	probably damaging	Het
Dhx33	A	G	11: 70,999,473	L240P	probably damaging	Het
Dna2	T	A	10: 62,960,275	D494E	probably benign	Het
Dnah7c	C	T	1: 46,632,310	R1620C	probably damaging	Het
Dpp8	G	A	9: 65,054,958	V427M	probably benign	Het
Dpt	G	A	1: 164,796,831	G34S	unknown	Het
Emb	T	A	13: 117,264,510	N198K	probably damaging	Het
Entpd5	T	G	12: 84,396,708	H62P	probably damaging	Het
Ep300	A	C	15: 81,621,152	M658L	unknown	Het
Epb41l4a	T	A	18: 33,797,451	D651V	probably damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ephb2	A	T	4: 136,771,108	V220E	probably damaging	Het
Fam187a	T	A	11: 102,886,048	L226H	possibly damaging	Het
Fbxo42	G	A	4: 141,199,818	A470T	probably benign	Het
Fcgrt	C	T	7: 45,095,251	W264*	probably null	Het
Flt3	A	C	5: 147,349,576	H733Q	probably benign	Het
Gabrr2	A	G	4: 33,082,560	D228G	probably damaging	Het
Gars	T	C	6: 55,077,750	S681P	probably damaging	Het
Gata2	T	C	6: 88,200,408	V140A	possibly damaging	Het
Gm8232	A	T	14: 44,434,927	N100I		Het
Grik4	A	G	9: 42,688,071	C37R	probably damaging	Het
Grm8	T	C	6: 27,618,679	E388G	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igsf9b	C	T	9: 27,323,312	T491I	probably damaging	Het
Impa1	C	T	3: 10,324,087	V105I	probably damaging	Het
Inf2	A	G	12: 112,601,337	T134A	probably damaging	Het
Itgb4	T	A	11: 116,006,476	V1521E	probably benign	Het
Iws1	T	A	18: 32,089,487	D623E	probably benign	Het
Lhfpl5	T	C	17: 28,576,331	S111P	possibly damaging	Het
Lyzl1	T	C	18: 4,169,244	C83R	probably damaging	Het
Madd	G	A	2: 91,169,710	T617M	possibly damaging	Het
Magi2	A	G	5: 20,228,385	T163A	probably damaging	Het
Mdn1	C	A	4: 32,694,599	H1107Q	probably damaging	Het
Mfsd14b	A	T	13: 65,066,777	Y454N	probably benign	Het
Mrgprb3	T	A	7: 48,643,114	I230F	probably benign	Het
Mroh2b	C	T	15: 4,945,023	L1162F	probably damaging	Het
Olfr1019	A	G	2: 85,841,039	F251L	probably benign	Het
Olfr170	T	C	16: 19,606,272	Y131C	probably damaging	Het
Olfr266	G	T	3: 106,822,021	H179Q	probably damaging	Het
Olfr311	A	G	11: 58,841,500	I129V	probably benign	Het
Olfr560	C	T	7: 102,753,745	M61I	probably benign	Het
Olfr631	T	C	7: 103,928,868	L15P	probably damaging	Het
Pclo	T	C	5: 14,679,036	L2636P	unknown	Het
Pfkm	G	A	15: 98,121,310	A181T	probably damaging	Het
Pik3r1	C	T	13: 101,702,838	A169T	probably benign	Het
R3hdml	T	A	2: 163,495,768	M114K	probably damaging	Het
Robo1	C	A	16: 73,024,301	R1310S	probably benign	Het
Scnm1	A	T	3: 95,132,875	N115K	probably benign	Het
Sfn	A	G	4: 133,601,237	V178A	probably damaging	Het
Shank2	C	T	7: 144,091,779	T366I	possibly damaging	Het
Siah1a	T	C	8: 86,725,325	D177G	probably damaging	Het
Slc37a2	A	C	9: 37,237,328	I286S	possibly damaging	Het
Smarce1	T	C	11: 99,228,292	T12A	probably benign	Het
Spata31d1c	T	A	13: 65,035,840	S399T	probably benign	Het
Specc1	A	G	11: 62,211,680	S942G	possibly damaging	Het
Syt13	T	C	2: 92,943,133	F164S	probably benign	Het
Topbp1	A	T	9: 103,332,706	T851S	probably benign	Het
Ttn	A	T	2: 76,969,671	S398T	unknown	Het
Vmn1r12	T	C	6: 57,159,536	V206A	probably damaging	Het
Vmn1r224	G	A	17: 20,419,959	W266*	probably null	Het
Vps13b	G	T	15: 35,770,646	K2078N	probably damaging	Het
Zfp251	A	C	15: 76,854,357	F179V	possibly damaging	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GAGAGGTGTAGTCTCCATACAC -3'
(R):5'- TTCTAGAATGAATACCCTCAGGTC -3'

Sequencing Primer
(F):5'- GAGGTGTAGTCTCCATACACTATCAC -3'
(R):5'- ACACACTCTACATCATTGCCTATG -3'

Posted On

2019-10-24