Incidental Mutation 'R7605:Grik4'
ID588248
Institutional Source Beutler Lab
Gene Symbol Grik4
Ensembl Gene ENSMUSG00000032017
Gene Nameglutamate receptor, ionotropic, kainate 4
Synonyms6330551K01Rik, GluRgamma1, KA-1, KA1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7605 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location42518135-42944493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42688071 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 37 (C37R)
Ref Sequence ENSEMBL: ENSMUSP00000110515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034515] [ENSMUST00000114865]
Predicted Effect probably damaging
Transcript: ENSMUST00000034515
AA Change: C37R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034515
Gene: ENSMUSG00000032017
AA Change: C37R

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 2.7e-60 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114865
AA Change: C37R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110515
Gene: ENSMUSG00000032017
AA Change: C37R

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 5.1e-66 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced GYKI-resistant excitatory postsynaptic current. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,918,164 L610P probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dnah7c C T 1: 46,632,310 R1620C probably damaging Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Ep300 A C 15: 81,621,152 M658L unknown Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ephb2 A T 4: 136,771,108 V220E probably damaging Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr170 T C 16: 19,606,272 Y131C probably damaging Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Robo1 C A 16: 73,024,301 R1310S probably benign Het
Scnm1 A T 3: 95,132,875 N115K probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Topbp1 A T 9: 103,332,706 T851S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Grik4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Grik4 APN 9 42521176 missense probably damaging 0.99
IGL01929:Grik4 APN 9 42566298 critical splice donor site probably null
IGL02049:Grik4 APN 9 42543753 splice site probably benign
IGL02331:Grik4 APN 9 42541988 missense probably damaging 1.00
IGL02652:Grik4 APN 9 42675277 missense possibly damaging 0.94
IGL02817:Grik4 APN 9 42622939 missense probably benign 0.00
IGL02945:Grik4 APN 9 42597879 missense possibly damaging 0.92
IGL03100:Grik4 APN 9 42550455 missense probably damaging 0.99
IGL03168:Grik4 APN 9 42671243 missense probably damaging 1.00
R0420:Grik4 UTSW 9 42622096 nonsense probably null
R0894:Grik4 UTSW 9 42688109 splice site probably benign
R1458:Grik4 UTSW 9 42521122 missense probably benign 0.21
R1502:Grik4 UTSW 9 42520873 missense probably damaging 0.97
R1502:Grik4 UTSW 9 42591447 missense probably benign 0.03
R1808:Grik4 UTSW 9 42629026 missense probably benign 0.19
R1945:Grik4 UTSW 9 42521004 missense possibly damaging 0.79
R2180:Grik4 UTSW 9 42542005 missense probably benign 0.45
R2203:Grik4 UTSW 9 42547655 missense probably damaging 1.00
R2336:Grik4 UTSW 9 42566355 missense probably damaging 1.00
R2508:Grik4 UTSW 9 42622142 missense probably damaging 1.00
R2890:Grik4 UTSW 9 42671219 missense probably damaging 1.00
R3702:Grik4 UTSW 9 42675218 missense probably damaging 0.97
R3834:Grik4 UTSW 9 42629123 missense probably benign 0.04
R4082:Grik4 UTSW 9 42597884 missense probably benign 0.00
R4604:Grik4 UTSW 9 42524586 missense probably damaging 1.00
R4711:Grik4 UTSW 9 42629093 missense probably damaging 1.00
R5417:Grik4 UTSW 9 42671248 missense probably benign 0.45
R5540:Grik4 UTSW 9 42520947 missense probably damaging 0.99
R5680:Grik4 UTSW 9 42629119 missense probably benign
R5740:Grik4 UTSW 9 42808567 missense possibly damaging 0.88
R5876:Grik4 UTSW 9 42688023 missense probably damaging 1.00
R5911:Grik4 UTSW 9 42591424 missense probably damaging 1.00
R6319:Grik4 UTSW 9 42566336 missense probably damaging 1.00
R6475:Grik4 UTSW 9 42629008 missense probably benign 0.01
R6544:Grik4 UTSW 9 42547728 nonsense probably null
R7065:Grik4 UTSW 9 42543831 missense probably damaging 1.00
R7278:Grik4 UTSW 9 42622060 missense probably benign 0.25
X0028:Grik4 UTSW 9 42675227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGTATCGGAGGCCTGG -3'
(R):5'- ATGCAGCAAACTCACTCTGGAG -3'

Sequencing Primer
(F):5'- TATCGGAGGCCTGGCACTTAG -3'
(R):5'- AGAGTTCTGTGGATGTCGAAG -3'
Posted On2019-10-24