Incidental Mutation 'R7605:Topbp1'
ID588250
Institutional Source Beutler Lab
Gene Symbol Topbp1
Ensembl Gene ENSMUSG00000032555
Gene Nametopoisomerase (DNA) II binding protein 1
SynonymsD430026L04Rik, 2810429C13Rik, 1110031N14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7605 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location103305215-103350428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103332706 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 851 (T851S)
Ref Sequence ENSEMBL: ENSMUSP00000035164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035164]
Predicted Effect probably benign
Transcript: ENSMUST00000035164
AA Change: T851S

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555
AA Change: T851S

DomainStartEndE-ValueType
BRCT 6 91 3.04e1 SMART
BRCT 103 179 1.51e-13 SMART
BRCT 197 274 4.69e-19 SMART
BRCT 355 433 3.58e-15 SMART
BRCT 553 626 5.57e-3 SMART
BRCT 646 731 1.53e-9 SMART
BRCT 904 983 3.48e-13 SMART
low complexity region 1097 1106 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1213 1218 N/A INTRINSIC
BRCT 1258 1337 2.31e-9 SMART
Blast:BRCT 1387 1472 4e-52 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185721
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,918,164 L610P probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dnah7c C T 1: 46,632,310 R1620C probably damaging Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Ep300 A C 15: 81,621,152 M658L unknown Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ephb2 A T 4: 136,771,108 V220E probably damaging Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grik4 A G 9: 42,688,071 C37R probably damaging Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr170 T C 16: 19,606,272 Y131C probably damaging Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Robo1 C A 16: 73,024,301 R1310S probably benign Het
Scnm1 A T 3: 95,132,875 N115K probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Topbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Topbp1 APN 9 103344943 missense probably benign
IGL01524:Topbp1 APN 9 103311645 missense possibly damaging 0.92
IGL02335:Topbp1 APN 9 103328523 missense probably damaging 1.00
IGL02441:Topbp1 APN 9 103320239 missense possibly damaging 0.49
IGL02943:Topbp1 APN 9 103328440 missense probably benign 0.00
IGL02953:Topbp1 APN 9 103328435 missense probably benign 0.26
IGL03040:Topbp1 APN 9 103328667 missense possibly damaging 0.51
PIT4377001:Topbp1 UTSW 9 103309889 missense possibly damaging 0.90
R0044:Topbp1 UTSW 9 103325773 missense possibly damaging 0.94
R0344:Topbp1 UTSW 9 103328687 missense probably damaging 0.99
R0344:Topbp1 UTSW 9 103308733 splice site probably benign
R0591:Topbp1 UTSW 9 103349838 missense probably benign 0.01
R0666:Topbp1 UTSW 9 103308812 missense probably benign
R0785:Topbp1 UTSW 9 103315090 missense probably damaging 1.00
R0906:Topbp1 UTSW 9 103328593 missense probably benign 0.00
R1352:Topbp1 UTSW 9 103347008 missense probably benign
R1745:Topbp1 UTSW 9 103308845 missense probably benign 0.36
R2104:Topbp1 UTSW 9 103317982 splice site probably benign
R2166:Topbp1 UTSW 9 103312929 unclassified probably null
R2230:Topbp1 UTSW 9 103345848 missense probably damaging 1.00
R2967:Topbp1 UTSW 9 103342140 missense probably benign 0.01
R3845:Topbp1 UTSW 9 103309923 missense possibly damaging 0.87
R4089:Topbp1 UTSW 9 103324501 critical splice donor site probably null
R4110:Topbp1 UTSW 9 103309959 missense probably damaging 0.98
R4454:Topbp1 UTSW 9 103344871 missense probably damaging 1.00
R4521:Topbp1 UTSW 9 103334202 intron probably benign
R4745:Topbp1 UTSW 9 103323571 missense probably damaging 1.00
R4923:Topbp1 UTSW 9 103312836 missense probably benign 0.00
R4934:Topbp1 UTSW 9 103328369 unclassified probably benign
R4963:Topbp1 UTSW 9 103320605 missense probably benign 0.04
R5199:Topbp1 UTSW 9 103346672 unclassified probably benign
R5461:Topbp1 UTSW 9 103315196 missense probably benign 0.00
R5517:Topbp1 UTSW 9 103336114 missense probably benign 0.03
R5563:Topbp1 UTSW 9 103311513 missense possibly damaging 0.46
R5564:Topbp1 UTSW 9 103334078 missense probably damaging 1.00
R5683:Topbp1 UTSW 9 103312804 missense possibly damaging 0.93
R5774:Topbp1 UTSW 9 103328499 missense probably benign 0.06
R5785:Topbp1 UTSW 9 103323528 missense probably benign 0.00
R6029:Topbp1 UTSW 9 103344953 missense probably benign 0.00
R6077:Topbp1 UTSW 9 103332990 missense probably damaging 1.00
R6122:Topbp1 UTSW 9 103346961 missense probably benign 0.06
R6133:Topbp1 UTSW 9 103311764 unclassified probably null
R6213:Topbp1 UTSW 9 103332751 missense probably benign 0.12
R6773:Topbp1 UTSW 9 103343692 missense possibly damaging 0.90
R6922:Topbp1 UTSW 9 103335846 missense probably damaging 1.00
R6938:Topbp1 UTSW 9 103328554 missense probably damaging 1.00
R7305:Topbp1 UTSW 9 103328637 missense probably damaging 1.00
R7419:Topbp1 UTSW 9 103323344 missense probably benign
R7517:Topbp1 UTSW 9 103332733 missense possibly damaging 0.82
R7701:Topbp1 UTSW 9 103332985 missense probably damaging 0.96
R7741:Topbp1 UTSW 9 103320557 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGCTGAAAAGGTAAGTATGCC -3'
(R):5'- TTGACATGCATTAGGGACACC -3'

Sequencing Primer
(F):5'- TATAGTTGTGAGCCACCACG -3'
(R):5'- GGACACCTTCCATTTAATAAGAAAAC -3'
Posted On2019-10-24