Mutagenetix > Incidental Mutations

Incidental Mutation 'R7605:Inf2'

588259

Institutional Source

Beutler Lab

Gene Symbol

Inf2

Ensembl Gene

ENSMUSG00000037679

Gene Name

inverted formin, FH2 and WH2 domain containing

Synonyms

2610204M08Rik, EG629699

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7605 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112588784-112615557 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112601337 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 134 (T134A)

Ref Sequence

ENSEMBL: ENSMUSP00000098591 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101029] [ENSMUST00000220786]

Predicted Effect

probably damaging
Transcript: ENSMUST00000101029
AA Change: T134A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098591
Gene: ENSMUSG00000037679
AA Change: T134A

Domain	Start	End	E-Value	Type
Drf_GBD	1	152	3.47e-34	SMART
Drf_FH3	156	343	2.18e-58	SMART
low complexity region	359	382	N/A	INTRINSIC
low complexity region	420	518	N/A	INTRINSIC
low complexity region	525	557	N/A	INTRINSIC
FH2	587	1030	1.96e-53	SMART
WH2	1005	1020	1.68e-2	SMART
Blast:FH2	1049	1179	3e-28	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000220786

Predicted Effect

probably benign
Transcript: ENSMUST00000222275

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display placental vasculopathy, restricted fetal growth, increased gestational length and transient increase in maternal blood pressure in the late stages of pregnancy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	G	12: 118,918,164	L610P	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Asphd2	A	G	5: 112,391,941	W9R	probably damaging	Het
Blvrb	T	A	7: 27,465,793	H179Q	probably damaging	Het
Capn13	A	T	17: 73,345,137		probably null	Het
Casp6	A	T	3: 129,912,163	M160L	probably benign	Het
Chordc1	A	G	9: 18,304,372	E140G	probably benign	Het
Col24a1	A	T	3: 145,538,687	Y1572F	possibly damaging	Het
Cul9	A	G	17: 46,541,732	S235P	probably damaging	Het
Cyp2u1	A	T	3: 131,297,953	M306K	probably damaging	Het
Dhx33	A	G	11: 70,999,473	L240P	probably damaging	Het
Dna2	T	A	10: 62,960,275	D494E	probably benign	Het
Dnah7c	C	T	1: 46,632,310	R1620C	probably damaging	Het
Dpp8	G	A	9: 65,054,958	V427M	probably benign	Het
Dpt	G	A	1: 164,796,831	G34S	unknown	Het
Emb	T	A	13: 117,264,510	N198K	probably damaging	Het
Entpd5	T	G	12: 84,396,708	H62P	probably damaging	Het
Ep300	A	C	15: 81,621,152	M658L	unknown	Het
Epb41l4a	T	A	18: 33,797,451	D651V	probably damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ephb2	A	T	4: 136,771,108	V220E	probably damaging	Het
Fam187a	T	A	11: 102,886,048	L226H	possibly damaging	Het
Fbxo42	G	A	4: 141,199,818	A470T	probably benign	Het
Fcgrt	C	T	7: 45,095,251	W264*	probably null	Het
Flt3	A	C	5: 147,349,576	H733Q	probably benign	Het
Gabrr2	A	G	4: 33,082,560	D228G	probably damaging	Het
Gars	T	C	6: 55,077,750	S681P	probably damaging	Het
Gata2	T	C	6: 88,200,408	V140A	possibly damaging	Het
Gm8232	A	T	14: 44,434,927	N100I		Het
Grik4	A	G	9: 42,688,071	C37R	probably damaging	Het
Grm8	T	C	6: 27,618,679	E388G	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911		probably null	Het
Igsf9b	C	T	9: 27,323,312	T491I	probably damaging	Het
Impa1	C	T	3: 10,324,087	V105I	probably damaging	Het
Itgb4	T	A	11: 116,006,476	V1521E	probably benign	Het
Iws1	T	A	18: 32,089,487	D623E	probably benign	Het
Lhfpl5	T	C	17: 28,576,331	S111P	possibly damaging	Het
Lyzl1	T	C	18: 4,169,244	C83R	probably damaging	Het
Madd	G	A	2: 91,169,710	T617M	possibly damaging	Het
Magi2	A	G	5: 20,228,385	T163A	probably damaging	Het
Mdn1	C	A	4: 32,694,599	H1107Q	probably damaging	Het
Mfsd14b	A	T	13: 65,066,777	Y454N	probably benign	Het
Mrgprb3	T	A	7: 48,643,114	I230F	probably benign	Het
Mroh2b	C	T	15: 4,945,023	L1162F	probably damaging	Het
Olfr1019	A	G	2: 85,841,039	F251L	probably benign	Het
Olfr170	T	C	16: 19,606,272	Y131C	probably damaging	Het
Olfr266	G	T	3: 106,822,021	H179Q	probably damaging	Het
Olfr311	A	G	11: 58,841,500	I129V	probably benign	Het
Olfr560	C	T	7: 102,753,745	M61I	probably benign	Het
Olfr631	T	C	7: 103,928,868	L15P	probably damaging	Het
Pclo	T	C	5: 14,679,036	L2636P	unknown	Het
Pfkm	G	A	15: 98,121,310	A181T	probably damaging	Het
Pik3r1	C	T	13: 101,702,838	A169T	probably benign	Het
R3hdml	T	A	2: 163,495,768	M114K	probably damaging	Het
Robo1	C	A	16: 73,024,301	R1310S	probably benign	Het
Scnm1	A	T	3: 95,132,875	N115K	probably benign	Het
Sfn	A	G	4: 133,601,237	V178A	probably damaging	Het
Shank2	C	T	7: 144,091,779	T366I	possibly damaging	Het
Siah1a	T	C	8: 86,725,325	D177G	probably damaging	Het
Slc37a2	A	C	9: 37,237,328	I286S	possibly damaging	Het
Smarce1	T	C	11: 99,228,292	T12A	probably benign	Het
Spata31d1c	T	A	13: 65,035,840	S399T	probably benign	Het
Specc1	A	G	11: 62,211,680	S942G	possibly damaging	Het
Syt13	T	C	2: 92,943,133	F164S	probably benign	Het
Topbp1	A	T	9: 103,332,706	T851S	probably benign	Het
Ttn	A	T	2: 76,969,671	S398T	unknown	Het
Vmn1r12	T	C	6: 57,159,536	V206A	probably damaging	Het
Vmn1r224	G	A	17: 20,419,959	W266*	probably null	Het
Vmn2r68	T	C	7: 85,233,908	D212G	probably benign	Het
Vps13b	G	T	15: 35,770,646	K2078N	probably damaging	Het
Zfp251	A	C	15: 76,854,357	F179V	possibly damaging	Het

Other mutations in Inf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Inf2	APN	12	112611856	nonsense	probably null
IGL01582:Inf2	APN	12	112610559	missense	unknown
IGL02078:Inf2	APN	12	112601614	missense	probably damaging	1.00
IGL02534:Inf2	APN	12	112610496	missense	unknown
IGL03122:Inf2	APN	12	112604229	missense	probably benign	0.03
IGL03296:Inf2	APN	12	112604208	nonsense	probably null
Talon	UTSW	12	112610287	splice site	probably benign
R0413:Inf2	UTSW	12	112601676	missense	probably damaging	1.00
R0552:Inf2	UTSW	12	112612574	intron	probably benign
R0920:Inf2	UTSW	12	112610287	splice site	probably benign
R1240:Inf2	UTSW	12	112610776	missense	unknown
R1452:Inf2	UTSW	12	112601344	missense	probably damaging	0.99
R1974:Inf2	UTSW	12	112608337	missense	unknown
R2422:Inf2	UTSW	12	112610824	missense	unknown
R3877:Inf2	UTSW	12	112610830	missense	unknown
R4108:Inf2	UTSW	12	112607581	missense	unknown
R4490:Inf2	UTSW	12	112600204	missense	probably damaging	1.00
R5071:Inf2	UTSW	12	112612039	splice site	probably null
R5074:Inf2	UTSW	12	112612039	splice site	probably null
R5306:Inf2	UTSW	12	112601553	missense	probably benign	0.26
R5383:Inf2	UTSW	12	112600145	missense	probably damaging	0.99
R5569:Inf2	UTSW	12	112601679	missense	possibly damaging	0.80
R5664:Inf2	UTSW	12	112611728	missense	unknown
R6157:Inf2	UTSW	12	112604788	unclassified	probably benign
R6221:Inf2	UTSW	12	112603745	missense	possibly damaging	0.66
R6429:Inf2	UTSW	12	112604256	missense	probably benign	0.01
R6955:Inf2	UTSW	12	112610731	missense	unknown
R7423:Inf2	UTSW	12	112609738	missense	unknown
R7444:Inf2	UTSW	12	112605387	missense	unknown
R7496:Inf2	UTSW	12	112600318	missense	probably damaging	1.00
R7678:Inf2	UTSW	12	112606994	missense	unknown
R7708:Inf2	UTSW	12	112607557	missense	unknown
R7752:Inf2	UTSW	12	112609684	missense	unknown
R7903:Inf2	UTSW	12	112612554	missense	unknown
R7986:Inf2	UTSW	12	112612554	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCGGGGTACTGGGAAAGATC -3'
(R):5'- ACGTTGTCACTGTCCGAGAG -3'

Sequencing Primer
(F):5'- TCAGTATGGCAAAGCTGGGC -3'
(R):5'- GCTCACTCATGATGACGCTGAAG -3'

Posted On

2019-10-24