Incidental Mutation 'R7605:Abcb5'
ID588260
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R7605 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118918164 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 610 (L610P)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably damaging
Transcript: ENSMUST00000035515
AA Change: L610P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: L610P

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dnah7c C T 1: 46,632,310 R1620C probably damaging Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Ep300 A C 15: 81,621,152 M658L unknown Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ephb2 A T 4: 136,771,108 V220E probably damaging Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grik4 A G 9: 42,688,071 C37R probably damaging Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr170 T C 16: 19,606,272 Y131C probably damaging Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Robo1 C A 16: 73,024,301 R1310S probably benign Het
Scnm1 A T 3: 95,132,875 N115K probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Topbp1 A T 9: 103,332,706 T851S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R8177:Abcb5 UTSW 12 118872790 missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118874732 missense probably benign 0.01
R8544:Abcb5 UTSW 12 118868726 missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118877831 missense probably benign 0.07
R8790:Abcb5 UTSW 12 118867885 missense possibly damaging 0.91
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118918272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTGCACAACCAAGTGG -3'
(R):5'- GCCCTGACTATTGCACAAGTTATC -3'

Sequencing Primer
(F):5'- GATTGTCTTTTTAATCTCTGCATTGC -3'
(R):5'- GCACAAGTTATCTCTAACACTCTTC -3'
Posted On2019-10-24