Incidental Mutation 'R7605:Ep300'
ID588269
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7605 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 81621152 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 658 (M658L)
Ref Sequence ENSEMBL: ENSMUSP00000066789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387] [ENSMUST00000206936]
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: M658L
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: M658L

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000206936
AA Change: M31L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,918,164 L610P probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dnah7c C T 1: 46,632,310 R1620C probably damaging Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ephb2 A T 4: 136,771,108 V220E probably damaging Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grik4 A G 9: 42,688,071 C37R probably damaging Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr170 T C 16: 19,606,272 Y131C probably damaging Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Robo1 C A 16: 73,024,301 R1310S probably benign Het
Scnm1 A T 3: 95,132,875 N115K probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Topbp1 A T 9: 103,332,706 T851S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
BB001:Ep300 UTSW 15 81649502 missense unknown
BB011:Ep300 UTSW 15 81649502 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0145:Ep300 UTSW 15 81616127 critical splice donor site probably null
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R1893:Ep300 UTSW 15 81631646 unclassified probably benign
R2136:Ep300 UTSW 15 81640447 missense unknown
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4575:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R5021:Ep300 UTSW 15 81640023 missense unknown
R5366:Ep300 UTSW 15 81616100 missense probably benign 0.24
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
R7327:Ep300 UTSW 15 81627314 missense unknown
R7378:Ep300 UTSW 15 81650545 missense probably damaging 0.97
R7388:Ep300 UTSW 15 81648366 missense unknown
R7419:Ep300 UTSW 15 81648514 missense unknown
R7498:Ep300 UTSW 15 81639843 missense unknown
R7584:Ep300 UTSW 15 81628426 missense unknown
R7619:Ep300 UTSW 15 81608198 missense unknown
R7699:Ep300 UTSW 15 81586393 start gained probably benign
R7763:Ep300 UTSW 15 81586583 start gained probably benign
R7775:Ep300 UTSW 15 81586686 missense unknown
R7778:Ep300 UTSW 15 81586686 missense unknown
R7862:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R7924:Ep300 UTSW 15 81649502 missense unknown
R8155:Ep300 UTSW 15 81621068 missense unknown
R8259:Ep300 UTSW 15 81639017 missense unknown
R8276:Ep300 UTSW 15 81650028 missense possibly damaging 0.85
R8331:Ep300 UTSW 15 81601210 missense unknown
R8554:Ep300 UTSW 15 81639027 missense unknown
RF020:Ep300 UTSW 15 81586571 start gained probably benign
Z1177:Ep300 UTSW 15 81630097 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCTTGAACAGTTGCTGTACTG -3'
(R):5'- TTCTACTTGGAAGGCTCCCTTG -3'

Sequencing Primer
(F):5'- TCAAGACAGGGTTTCTCTGAGAC -3'
(R):5'- GCTCCCTTGAGGAGTAAAAA -3'
Posted On2019-10-24