Incidental Mutation 'R7605:Olfr170'
ID588271
Institutional Source Beutler Lab
Gene Symbol Olfr170
Ensembl Gene ENSMUSG00000062245
Gene Nameolfactory receptor 170
SynonymsGA_x54KRFPKG5P-16052703-16051765, MOR273-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7605 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location19605696-19611882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19606272 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 131 (Y131C)
Ref Sequence ENSEMBL: ENSMUSP00000145775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]
Predicted Effect probably damaging
Transcript: ENSMUST00000078603
AA Change: Y131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: Y131C

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.5e-43 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206562
AA Change: Y131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218837
AA Change: Y132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,918,164 L610P probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dnah7c C T 1: 46,632,310 R1620C probably damaging Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Ep300 A C 15: 81,621,152 M658L unknown Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ephb2 A T 4: 136,771,108 V220E probably damaging Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grik4 A G 9: 42,688,071 C37R probably damaging Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Robo1 C A 16: 73,024,301 R1310S probably benign Het
Scnm1 A T 3: 95,132,875 N115K probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Topbp1 A T 9: 103,332,706 T851S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Olfr170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Olfr170 APN 16 19605921 missense probably benign 0.00
IGL02002:Olfr170 APN 16 19606550 missense possibly damaging 0.91
IGL02537:Olfr170 APN 16 19605799 missense probably damaging 1.00
IGL02881:Olfr170 APN 16 19606300 missense probably damaging 1.00
IGL03189:Olfr170 APN 16 19606591 missense probably benign
R0012:Olfr170 UTSW 16 19606440 missense probably benign 0.30
R0619:Olfr170 UTSW 16 19606272 missense probably damaging 1.00
R0764:Olfr170 UTSW 16 19606432 missense probably damaging 1.00
R1387:Olfr170 UTSW 16 19606027 missense probably damaging 1.00
R1430:Olfr170 UTSW 16 19606002 missense probably damaging 1.00
R1503:Olfr170 UTSW 16 19606312 missense probably benign 0.19
R1878:Olfr170 UTSW 16 19605751 missense probably benign
R1989:Olfr170 UTSW 16 19606657 missense probably benign 0.00
R2012:Olfr170 UTSW 16 19606131 missense probably benign 0.22
R3890:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R3891:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R5591:Olfr170 UTSW 16 19605858 missense probably damaging 1.00
R6158:Olfr170 UTSW 16 19605925 missense probably damaging 1.00
R6297:Olfr170 UTSW 16 19605930 missense possibly damaging 0.81
R6512:Olfr170 UTSW 16 19606359 missense probably damaging 1.00
R6962:Olfr170 UTSW 16 19605922 missense probably benign 0.00
R7252:Olfr170 UTSW 16 19606499 missense probably damaging 0.99
R7687:Olfr170 UTSW 16 19605735 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAACTTCAACATGGCAGGG -3'
(R):5'- GATTCTCGACTCCATACCCCAATG -3'

Sequencing Primer
(F):5'- TTCAACATGGCAGGGACTTC -3'
(R):5'- CATGGATATCTTGCACATTTCCAAC -3'
Posted On2019-10-24