Incidental Mutation 'R7605:Robo1'
ID588272
Institutional Source Beutler Lab
Gene Symbol Robo1
Ensembl Gene ENSMUSG00000022883
Gene Nameroundabout guidance receptor 1
SynonymsDUTT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7605 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location72308306-73046095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73024301 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1310 (R1310S)
Ref Sequence ENSEMBL: ENSMUSP00000023600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023600]
Predicted Effect probably benign
Transcript: ENSMUST00000023600
AA Change: R1310S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023600
Gene: ENSMUSG00000022883
AA Change: R1310S

DomainStartEndE-ValueType
IGc2 41 115 3.15e-10 SMART
IGc2 143 208 2.52e-9 SMART
IGc2 235 298 3.85e-14 SMART
IGv 328 391 3.71e-7 SMART
IGc2 428 493 2.46e-12 SMART
FN3 522 604 3.17e-13 SMART
FN3 634 721 1.66e0 SMART
FN3 736 822 4.28e-10 SMART
low complexity region 1108 1125 N/A INTRINSIC
low complexity region 1148 1157 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1249 1269 N/A INTRINSIC
low complexity region 1282 1298 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1362 1380 N/A INTRINSIC
low complexity region 1442 1449 N/A INTRINSIC
low complexity region 1563 1576 N/A INTRINSIC
low complexity region 1602 1611 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A G 12: 118,918,164 L610P probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Asphd2 A G 5: 112,391,941 W9R probably damaging Het
Blvrb T A 7: 27,465,793 H179Q probably damaging Het
Capn13 A T 17: 73,345,137 probably null Het
Casp6 A T 3: 129,912,163 M160L probably benign Het
Chordc1 A G 9: 18,304,372 E140G probably benign Het
Col24a1 A T 3: 145,538,687 Y1572F possibly damaging Het
Cul9 A G 17: 46,541,732 S235P probably damaging Het
Cyp2u1 A T 3: 131,297,953 M306K probably damaging Het
Dhx33 A G 11: 70,999,473 L240P probably damaging Het
Dna2 T A 10: 62,960,275 D494E probably benign Het
Dnah7c C T 1: 46,632,310 R1620C probably damaging Het
Dpp8 G A 9: 65,054,958 V427M probably benign Het
Dpt G A 1: 164,796,831 G34S unknown Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Entpd5 T G 12: 84,396,708 H62P probably damaging Het
Ep300 A C 15: 81,621,152 M658L unknown Het
Epb41l4a T A 18: 33,797,451 D651V probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Ephb2 A T 4: 136,771,108 V220E probably damaging Het
Fam187a T A 11: 102,886,048 L226H possibly damaging Het
Fbxo42 G A 4: 141,199,818 A470T probably benign Het
Fcgrt C T 7: 45,095,251 W264* probably null Het
Flt3 A C 5: 147,349,576 H733Q probably benign Het
Gabrr2 A G 4: 33,082,560 D228G probably damaging Het
Gars T C 6: 55,077,750 S681P probably damaging Het
Gata2 T C 6: 88,200,408 V140A possibly damaging Het
Gm8232 A T 14: 44,434,927 N100I Het
Grik4 A G 9: 42,688,071 C37R probably damaging Het
Grm8 T C 6: 27,618,679 E388G probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b C T 9: 27,323,312 T491I probably damaging Het
Impa1 C T 3: 10,324,087 V105I probably damaging Het
Inf2 A G 12: 112,601,337 T134A probably damaging Het
Itgb4 T A 11: 116,006,476 V1521E probably benign Het
Iws1 T A 18: 32,089,487 D623E probably benign Het
Lhfpl5 T C 17: 28,576,331 S111P possibly damaging Het
Lyzl1 T C 18: 4,169,244 C83R probably damaging Het
Madd G A 2: 91,169,710 T617M possibly damaging Het
Magi2 A G 5: 20,228,385 T163A probably damaging Het
Mdn1 C A 4: 32,694,599 H1107Q probably damaging Het
Mfsd14b A T 13: 65,066,777 Y454N probably benign Het
Mrgprb3 T A 7: 48,643,114 I230F probably benign Het
Mroh2b C T 15: 4,945,023 L1162F probably damaging Het
Olfr1019 A G 2: 85,841,039 F251L probably benign Het
Olfr170 T C 16: 19,606,272 Y131C probably damaging Het
Olfr266 G T 3: 106,822,021 H179Q probably damaging Het
Olfr311 A G 11: 58,841,500 I129V probably benign Het
Olfr560 C T 7: 102,753,745 M61I probably benign Het
Olfr631 T C 7: 103,928,868 L15P probably damaging Het
Pclo T C 5: 14,679,036 L2636P unknown Het
Pfkm G A 15: 98,121,310 A181T probably damaging Het
Pik3r1 C T 13: 101,702,838 A169T probably benign Het
R3hdml T A 2: 163,495,768 M114K probably damaging Het
Scnm1 A T 3: 95,132,875 N115K probably benign Het
Sfn A G 4: 133,601,237 V178A probably damaging Het
Shank2 C T 7: 144,091,779 T366I possibly damaging Het
Siah1a T C 8: 86,725,325 D177G probably damaging Het
Slc37a2 A C 9: 37,237,328 I286S possibly damaging Het
Smarce1 T C 11: 99,228,292 T12A probably benign Het
Spata31d1c T A 13: 65,035,840 S399T probably benign Het
Specc1 A G 11: 62,211,680 S942G possibly damaging Het
Syt13 T C 2: 92,943,133 F164S probably benign Het
Topbp1 A T 9: 103,332,706 T851S probably benign Het
Ttn A T 2: 76,969,671 S398T unknown Het
Vmn1r12 T C 6: 57,159,536 V206A probably damaging Het
Vmn1r224 G A 17: 20,419,959 W266* probably null Het
Vmn2r68 T C 7: 85,233,908 D212G probably benign Het
Vps13b G T 15: 35,770,646 K2078N probably damaging Het
Zfp251 A C 15: 76,854,357 F179V possibly damaging Het
Other mutations in Robo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Robo1 APN 16 73004665 missense probably benign 0.00
IGL01937:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL01945:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL02151:Robo1 APN 16 72989616 missense probably benign 0.00
IGL02232:Robo1 APN 16 72971984 missense possibly damaging 0.59
IGL02282:Robo1 APN 16 72742138 missense probably damaging 1.00
IGL02590:Robo1 APN 16 73043132 missense probably benign 0.06
IGL02874:Robo1 APN 16 73012918 missense probably damaging 0.96
IGL02974:Robo1 APN 16 73006862 missense probably benign 0.09
IGL03233:Robo1 APN 16 72970193 missense probably damaging 0.99
PIT4378001:Robo1 UTSW 16 73004535 missense probably damaging 1.00
R0079:Robo1 UTSW 16 72933342 splice site probably benign
R0254:Robo1 UTSW 16 72664170 missense probably benign 0.00
R0366:Robo1 UTSW 16 72742245 missense possibly damaging 0.52
R0410:Robo1 UTSW 16 72971984 missense possibly damaging 0.59
R0511:Robo1 UTSW 16 73013125 critical splice donor site probably null
R0563:Robo1 UTSW 16 72972286 missense probably benign 0.01
R0637:Robo1 UTSW 16 73001951 missense probably benign 0.29
R1239:Robo1 UTSW 16 73024542 splice site probably null
R1773:Robo1 UTSW 16 73004511 missense probably benign 0.00
R1777:Robo1 UTSW 16 73004667 missense probably benign
R1901:Robo1 UTSW 16 72960204 missense probably null 1.00
R1902:Robo1 UTSW 16 72960204 missense probably null 1.00
R1903:Robo1 UTSW 16 72960204 missense probably null 1.00
R1996:Robo1 UTSW 16 72970179 missense probably benign 0.40
R2040:Robo1 UTSW 16 72933742 missense probably damaging 1.00
R2266:Robo1 UTSW 16 72978772 missense probably benign
R2269:Robo1 UTSW 16 72978772 missense probably benign
R2433:Robo1 UTSW 16 72970239 missense probably benign 0.01
R3084:Robo1 UTSW 16 73004737 missense probably benign 0.02
R3085:Robo1 UTSW 16 73002010 missense possibly damaging 0.81
R3150:Robo1 UTSW 16 72970269 missense possibly damaging 0.57
R3418:Robo1 UTSW 16 73035917 missense probably benign 0.00
R3610:Robo1 UTSW 16 72983770 missense probably benign 0.00
R3940:Robo1 UTSW 16 73009743 missense probably benign
R3953:Robo1 UTSW 16 73024338 missense probably damaging 1.00
R4692:Robo1 UTSW 16 72960202 missense probably damaging 1.00
R4726:Robo1 UTSW 16 72972043 missense probably damaging 1.00
R4814:Robo1 UTSW 16 72972035 missense probably benign 0.11
R4884:Robo1 UTSW 16 72904751 missense probably damaging 1.00
R4992:Robo1 UTSW 16 72979868 missense probably damaging 0.98
R5150:Robo1 UTSW 16 72972304 missense possibly damaging 0.79
R5183:Robo1 UTSW 16 72742150 missense probably benign 0.03
R5360:Robo1 UTSW 16 72935777 missense probably damaging 0.96
R5629:Robo1 UTSW 16 72983710 missense probably benign 0.33
R5804:Robo1 UTSW 16 73043189 critical splice donor site probably null
R6107:Robo1 UTSW 16 72983829 missense probably benign 0.00
R6127:Robo1 UTSW 16 73013068 missense probably benign
R6128:Robo1 UTSW 16 73013068 missense probably benign
R6129:Robo1 UTSW 16 73013068 missense probably benign
R6191:Robo1 UTSW 16 72933808 missense probably benign 0.00
R6357:Robo1 UTSW 16 72970302 missense probably benign 0.00
R6408:Robo1 UTSW 16 72972046 missense probably benign 0.00
R6516:Robo1 UTSW 16 73024353 missense probably benign 0.14
R6600:Robo1 UTSW 16 72989655 missense probably damaging 1.00
R6802:Robo1 UTSW 16 72933313 missense probably benign 0.17
R7105:Robo1 UTSW 16 72742161 missense probably damaging 1.00
R7189:Robo1 UTSW 16 72960151 nonsense probably null
R7290:Robo1 UTSW 16 73004520 missense probably benign 0.03
R7296:Robo1 UTSW 16 72989631 nonsense probably null
R7576:Robo1 UTSW 16 72970181 missense probably damaging 0.99
R7607:Robo1 UTSW 16 72563738 missense
R7636:Robo1 UTSW 16 72563727 missense
R7857:Robo1 UTSW 16 72970211 missense probably damaging 1.00
R7940:Robo1 UTSW 16 72970211 missense probably damaging 1.00
R7997:Robo1 UTSW 16 72904693 missense not run
Z1176:Robo1 UTSW 16 72977800 missense not run
Predicted Primers PCR Primer
(F):5'- CTTCAACTTGCCGGTTAGTTATTG -3'
(R):5'- GGGCAAAATCAGCGTCAGTG -3'

Sequencing Primer
(F):5'- TTGTCTTCCTACAGGCGGCAG -3'
(R):5'- CGTCAGTGAAAAAGGAGCCATC -3'
Posted On2019-10-24