Mutagenetix > Incidental Mutations

Incidental Mutation 'R7605:Robo1'

588272

Institutional Source

Beutler Lab

Gene Symbol

Robo1

Ensembl Gene

ENSMUSG00000022883

Gene Name

roundabout guidance receptor 1

Synonyms

DUTT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7605 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72308306-73046095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 73024301 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1310 (R1310S)

Ref Sequence

ENSEMBL: ENSMUSP00000023600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023600]

Predicted Effect

probably benign
Transcript: ENSMUST00000023600
AA Change: R1310S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000023600
Gene: ENSMUSG00000022883
AA Change: R1310S

Domain	Start	End	E-Value	Type
IGc2	41	115	3.15e-10	SMART
IGc2	143	208	2.52e-9	SMART
IGc2	235	298	3.85e-14	SMART
IGv	328	391	3.71e-7	SMART
IGc2	428	493	2.46e-12	SMART
FN3	522	604	3.17e-13	SMART
FN3	634	721	1.66e0	SMART
FN3	736	822	4.28e-10	SMART
low complexity region	1108	1125	N/A	INTRINSIC
low complexity region	1148	1157	N/A	INTRINSIC
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1249	1269	N/A	INTRINSIC
low complexity region	1282	1298	N/A	INTRINSIC
low complexity region	1345	1357	N/A	INTRINSIC
low complexity region	1362	1380	N/A	INTRINSIC
low complexity region	1442	1449	N/A	INTRINSIC
low complexity region	1563	1576	N/A	INTRINSIC
low complexity region	1602	1611	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	G	12: 118,918,164	L610P	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Asphd2	A	G	5: 112,391,941	W9R	probably damaging	Het
Blvrb	T	A	7: 27,465,793	H179Q	probably damaging	Het
Capn13	A	T	17: 73,345,137		probably null	Het
Casp6	A	T	3: 129,912,163	M160L	probably benign	Het
Chordc1	A	G	9: 18,304,372	E140G	probably benign	Het
Col24a1	A	T	3: 145,538,687	Y1572F	possibly damaging	Het
Cul9	A	G	17: 46,541,732	S235P	probably damaging	Het
Cyp2u1	A	T	3: 131,297,953	M306K	probably damaging	Het
Dhx33	A	G	11: 70,999,473	L240P	probably damaging	Het
Dna2	T	A	10: 62,960,275	D494E	probably benign	Het
Dnah7c	C	T	1: 46,632,310	R1620C	probably damaging	Het
Dpp8	G	A	9: 65,054,958	V427M	probably benign	Het
Dpt	G	A	1: 164,796,831	G34S	unknown	Het
Emb	T	A	13: 117,264,510	N198K	probably damaging	Het
Entpd5	T	G	12: 84,396,708	H62P	probably damaging	Het
Ep300	A	C	15: 81,621,152	M658L	unknown	Het
Epb41l4a	T	A	18: 33,797,451	D651V	probably damaging	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Ephb2	A	T	4: 136,771,108	V220E	probably damaging	Het
Fam187a	T	A	11: 102,886,048	L226H	possibly damaging	Het
Fbxo42	G	A	4: 141,199,818	A470T	probably benign	Het
Fcgrt	C	T	7: 45,095,251	W264*	probably null	Het
Flt3	A	C	5: 147,349,576	H733Q	probably benign	Het
Gabrr2	A	G	4: 33,082,560	D228G	probably damaging	Het
Gars	T	C	6: 55,077,750	S681P	probably damaging	Het
Gata2	T	C	6: 88,200,408	V140A	possibly damaging	Het
Gm8232	A	T	14: 44,434,927	N100I		Het
Grik4	A	G	9: 42,688,071	C37R	probably damaging	Het
Grm8	T	C	6: 27,618,679	E388G	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911		probably null	Het
Igsf9b	C	T	9: 27,323,312	T491I	probably damaging	Het
Impa1	C	T	3: 10,324,087	V105I	probably damaging	Het
Inf2	A	G	12: 112,601,337	T134A	probably damaging	Het
Itgb4	T	A	11: 116,006,476	V1521E	probably benign	Het
Iws1	T	A	18: 32,089,487	D623E	probably benign	Het
Lhfpl5	T	C	17: 28,576,331	S111P	possibly damaging	Het
Lyzl1	T	C	18: 4,169,244	C83R	probably damaging	Het
Madd	G	A	2: 91,169,710	T617M	possibly damaging	Het
Magi2	A	G	5: 20,228,385	T163A	probably damaging	Het
Mdn1	C	A	4: 32,694,599	H1107Q	probably damaging	Het
Mfsd14b	A	T	13: 65,066,777	Y454N	probably benign	Het
Mrgprb3	T	A	7: 48,643,114	I230F	probably benign	Het
Mroh2b	C	T	15: 4,945,023	L1162F	probably damaging	Het
Olfr1019	A	G	2: 85,841,039	F251L	probably benign	Het
Olfr170	T	C	16: 19,606,272	Y131C	probably damaging	Het
Olfr266	G	T	3: 106,822,021	H179Q	probably damaging	Het
Olfr311	A	G	11: 58,841,500	I129V	probably benign	Het
Olfr560	C	T	7: 102,753,745	M61I	probably benign	Het
Olfr631	T	C	7: 103,928,868	L15P	probably damaging	Het
Pclo	T	C	5: 14,679,036	L2636P	unknown	Het
Pfkm	G	A	15: 98,121,310	A181T	probably damaging	Het
Pik3r1	C	T	13: 101,702,838	A169T	probably benign	Het
R3hdml	T	A	2: 163,495,768	M114K	probably damaging	Het
Scnm1	A	T	3: 95,132,875	N115K	probably benign	Het
Sfn	A	G	4: 133,601,237	V178A	probably damaging	Het
Shank2	C	T	7: 144,091,779	T366I	possibly damaging	Het
Siah1a	T	C	8: 86,725,325	D177G	probably damaging	Het
Slc37a2	A	C	9: 37,237,328	I286S	possibly damaging	Het
Smarce1	T	C	11: 99,228,292	T12A	probably benign	Het
Spata31d1c	T	A	13: 65,035,840	S399T	probably benign	Het
Specc1	A	G	11: 62,211,680	S942G	possibly damaging	Het
Syt13	T	C	2: 92,943,133	F164S	probably benign	Het
Topbp1	A	T	9: 103,332,706	T851S	probably benign	Het
Ttn	A	T	2: 76,969,671	S398T	unknown	Het
Vmn1r12	T	C	6: 57,159,536	V206A	probably damaging	Het
Vmn1r224	G	A	17: 20,419,959	W266*	probably null	Het
Vmn2r68	T	C	7: 85,233,908	D212G	probably benign	Het
Vps13b	G	T	15: 35,770,646	K2078N	probably damaging	Het
Zfp251	A	C	15: 76,854,357	F179V	possibly damaging	Het

Other mutations in Robo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01766:Robo1	APN	16	73004665	missense	probably benign	0.00
IGL01937:Robo1	APN	16	72962226	missense	probably damaging	1.00
IGL01945:Robo1	APN	16	72962226	missense	probably damaging	1.00
IGL02151:Robo1	APN	16	72989616	missense	probably benign	0.00
IGL02232:Robo1	APN	16	72971984	missense	possibly damaging	0.59
IGL02282:Robo1	APN	16	72742138	missense	probably damaging	1.00
IGL02590:Robo1	APN	16	73043132	missense	probably benign	0.06
IGL02874:Robo1	APN	16	73012918	missense	probably damaging	0.96
IGL02974:Robo1	APN	16	73006862	missense	probably benign	0.09
IGL03233:Robo1	APN	16	72970193	missense	probably damaging	0.99
PIT4378001:Robo1	UTSW	16	73004535	missense	probably damaging	1.00
R0079:Robo1	UTSW	16	72933342	splice site	probably benign
R0254:Robo1	UTSW	16	72664170	missense	probably benign	0.00
R0366:Robo1	UTSW	16	72742245	missense	possibly damaging	0.52
R0410:Robo1	UTSW	16	72971984	missense	possibly damaging	0.59
R0511:Robo1	UTSW	16	73013125	critical splice donor site	probably null
R0563:Robo1	UTSW	16	72972286	missense	probably benign	0.01
R0637:Robo1	UTSW	16	73001951	missense	probably benign	0.29
R1239:Robo1	UTSW	16	73024542	splice site	probably null
R1773:Robo1	UTSW	16	73004511	missense	probably benign	0.00
R1777:Robo1	UTSW	16	73004667	missense	probably benign
R1901:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1902:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1903:Robo1	UTSW	16	72960204	missense	probably null	1.00
R1996:Robo1	UTSW	16	72970179	missense	probably benign	0.40
R2040:Robo1	UTSW	16	72933742	missense	probably damaging	1.00
R2266:Robo1	UTSW	16	72978772	missense	probably benign
R2269:Robo1	UTSW	16	72978772	missense	probably benign
R2433:Robo1	UTSW	16	72970239	missense	probably benign	0.01
R3084:Robo1	UTSW	16	73004737	missense	probably benign	0.02
R3085:Robo1	UTSW	16	73002010	missense	possibly damaging	0.81
R3150:Robo1	UTSW	16	72970269	missense	possibly damaging	0.57
R3418:Robo1	UTSW	16	73035917	missense	probably benign	0.00
R3610:Robo1	UTSW	16	72983770	missense	probably benign	0.00
R3940:Robo1	UTSW	16	73009743	missense	probably benign
R3953:Robo1	UTSW	16	73024338	missense	probably damaging	1.00
R4692:Robo1	UTSW	16	72960202	missense	probably damaging	1.00
R4726:Robo1	UTSW	16	72972043	missense	probably damaging	1.00
R4814:Robo1	UTSW	16	72972035	missense	probably benign	0.11
R4884:Robo1	UTSW	16	72904751	missense	probably damaging	1.00
R4992:Robo1	UTSW	16	72979868	missense	probably damaging	0.98
R5150:Robo1	UTSW	16	72972304	missense	possibly damaging	0.79
R5183:Robo1	UTSW	16	72742150	missense	probably benign	0.03
R5360:Robo1	UTSW	16	72935777	missense	probably damaging	0.96
R5629:Robo1	UTSW	16	72983710	missense	probably benign	0.33
R5804:Robo1	UTSW	16	73043189	critical splice donor site	probably null
R6107:Robo1	UTSW	16	72983829	missense	probably benign	0.00
R6127:Robo1	UTSW	16	73013068	missense	probably benign
R6128:Robo1	UTSW	16	73013068	missense	probably benign
R6129:Robo1	UTSW	16	73013068	missense	probably benign
R6191:Robo1	UTSW	16	72933808	missense	probably benign	0.00
R6357:Robo1	UTSW	16	72970302	missense	probably benign	0.00
R6408:Robo1	UTSW	16	72972046	missense	probably benign	0.00
R6516:Robo1	UTSW	16	73024353	missense	probably benign	0.14
R6600:Robo1	UTSW	16	72989655	missense	probably damaging	1.00
R6802:Robo1	UTSW	16	72933313	missense	probably benign	0.17
R7105:Robo1	UTSW	16	72742161	missense	probably damaging	1.00
R7189:Robo1	UTSW	16	72960151	nonsense	probably null
R7290:Robo1	UTSW	16	73004520	missense	probably benign	0.03
R7296:Robo1	UTSW	16	72989631	nonsense	probably null
R7576:Robo1	UTSW	16	72970181	missense	probably damaging	0.99
R7607:Robo1	UTSW	16	72563738	missense
R7634:Robo1	UTSW	16	73042978	splice site	probably null
R7636:Robo1	UTSW	16	72563727	missense
R7857:Robo1	UTSW	16	72970211	missense	probably damaging	1.00
R7966:Robo1	UTSW	16	72983872	missense	possibly damaging	0.62
R7997:Robo1	UTSW	16	72904693	missense	probably damaging	1.00
R8101:Robo1	UTSW	16	72978581	missense	probably benign	0.03
R8191:Robo1	UTSW	16	72933254	missense	probably damaging	1.00
R8218:Robo1	UTSW	16	72989790	missense	possibly damaging	0.91
R8228:Robo1	UTSW	16	73012880	missense	probably benign	0.30
R8292:Robo1	UTSW	16	72972532	missense	possibly damaging	0.61
R8298:Robo1	UTSW	16	72972132	intron	probably benign
R8332:Robo1	UTSW	16	72978578	missense	probably damaging	1.00
R8402:Robo1	UTSW	16	73024497	missense	probably benign	0.16
R8492:Robo1	UTSW	16	73013023	missense	probably benign	0.06
Z1176:Robo1	UTSW	16	72977800	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CTTCAACTTGCCGGTTAGTTATTG -3'
(R):5'- GGGCAAAATCAGCGTCAGTG -3'

Sequencing Primer
(F):5'- TTGTCTTCCTACAGGCGGCAG -3'
(R):5'- CGTCAGTGAAAAAGGAGCCATC -3'

Posted On

2019-10-24