Incidental Mutation 'R7606:Or4c114'
ID 588285
Institutional Source Beutler Lab
Gene Symbol Or4c114
Ensembl Gene ENSMUSG00000075104
Gene Name olfactory receptor family 4 subfamily C member 114
Synonyms GA_x6K02T2Q125-50555603-50554668, MOR233-6, Olfr1219
MMRRC Submission 045676-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R7606 (G1)
Quality Score 134.008
Status Validated
Chromosome 2
Chromosomal Location 88904498-88905433 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) A to G at 88905641 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099797] [ENSMUST00000213724] [ENSMUST00000214442] [ENSMUST00000215225] [ENSMUST00000217421]
AlphaFold Q7TR04
Predicted Effect probably benign
Transcript: ENSMUST00000099797
SMART Domains Protein: ENSMUSP00000097385
Gene: ENSMUSG00000075104

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3e-46 PFAM
Pfam:7tm_1 39 286 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213724
Predicted Effect probably benign
Transcript: ENSMUST00000214442
Predicted Effect probably benign
Transcript: ENSMUST00000215225
Predicted Effect probably benign
Transcript: ENSMUST00000217421
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 59,943,456 (GRCm39) probably null Het
Adat1 T C 8: 112,709,236 (GRCm39) K196E possibly damaging Het
Aire T C 10: 77,873,767 (GRCm39) D314G probably damaging Het
Atp11a C T 8: 12,894,427 (GRCm39) T674I probably damaging Het
Atp8b1 T C 18: 64,688,186 (GRCm39) D644G probably damaging Het
Bag4 A G 8: 26,259,333 (GRCm39) S289P probably damaging Het
Bcat1 G T 6: 144,994,358 (GRCm39) H46Q probably benign Het
Btg4 A G 9: 51,029,307 (GRCm39) N164S probably damaging Het
Ccz1 G A 5: 143,951,626 (GRCm39) A2V probably benign Het
Cd209g T C 8: 4,186,839 (GRCm39) L128P probably damaging Het
Col4a2 T A 8: 11,493,571 (GRCm39) M1380K probably benign Het
Cpox T C 16: 58,494,812 (GRCm39) V283A probably benign Het
Dnah10 A T 5: 124,894,776 (GRCm39) D3504V probably benign Het
Eml1 A T 12: 108,503,625 (GRCm39) I741F probably benign Het
Fam171a2 A G 11: 102,335,002 (GRCm39) V45A possibly damaging Het
Fem1a A G 17: 56,563,946 (GRCm39) D13G probably damaging Het
Fkbp14 A G 6: 54,570,003 (GRCm39) I9T probably benign Het
Golt1b G A 6: 142,338,068 (GRCm39) G13D probably damaging Het
Heatr5b T C 17: 79,070,455 (GRCm39) N1653D probably benign Het
Hrg A G 16: 22,769,873 (GRCm39) M1V probably null Het
Itgb2 T A 10: 77,391,995 (GRCm39) I356N probably damaging Het
Kcnb2 A G 1: 15,383,064 (GRCm39) E130G probably damaging Het
Kpna2 A T 11: 106,882,884 (GRCm39) F124Y probably damaging Het
Lyst T C 13: 13,812,060 (GRCm39) I824T probably damaging Het
Meis2 T C 2: 115,893,801 (GRCm39) H38R possibly damaging Het
Mknk1 T G 4: 115,735,191 (GRCm39) I353S probably damaging Het
Mrc1 T A 2: 14,242,955 (GRCm39) I27N probably damaging Het
Mup4 T C 4: 59,958,568 (GRCm39) T111A probably damaging Het
Myo1f T C 17: 33,795,424 (GRCm39) V53A probably damaging Het
Neb T G 2: 52,116,456 (GRCm39) E994A Het
Nlrc5 T C 8: 95,203,745 (GRCm39) M615T possibly damaging Het
Nup88 T C 11: 70,852,441 (GRCm39) E218G possibly damaging Het
Or10g3b A T 14: 52,587,420 (GRCm39) F28I probably benign Het
Parp11 A G 6: 127,447,723 (GRCm39) D19G probably benign Het
Parp2 A T 14: 51,057,487 (GRCm39) T429S probably damaging Het
Pcdhb6 G A 18: 37,468,659 (GRCm39) E527K probably damaging Het
Pde8a A G 7: 80,982,715 (GRCm39) Y778C probably damaging Het
Pea15a T C 1: 172,028,150 (GRCm39) probably null Het
Plcd3 A G 11: 102,967,683 (GRCm39) Y420H probably damaging Het
Ppp1ca C A 19: 4,243,088 (GRCm39) S85R possibly damaging Het
Pth A C 7: 112,985,450 (GRCm39) I13S probably benign Het
Rbm27 A G 18: 42,460,578 (GRCm39) T842A probably damaging Het
Rcbtb2 T A 14: 73,419,806 (GRCm39) probably null Het
Rubcnl C T 14: 75,276,314 (GRCm39) L323F probably benign Het
Ryr3 A T 2: 112,475,590 (GRCm39) Y4539* probably null Het
Scamp3 T A 3: 89,088,525 (GRCm39) F244I probably damaging Het
Sema4d T C 13: 51,877,658 (GRCm39) D58G probably benign Het
Skor1 G T 9: 63,052,664 (GRCm39) A435E probably damaging Het
Slc35a4 A G 18: 36,815,638 (GRCm39) Y156C probably benign Het
Spryd7 T C 14: 61,777,607 (GRCm39) T158A possibly damaging Het
Srgap3 A C 6: 112,716,337 (GRCm39) I621S probably benign Het
Tbc1d31 A G 15: 57,815,066 (GRCm39) E581G probably damaging Het
Tcf4 C T 18: 69,776,054 (GRCm39) T318I probably damaging Het
Usf3 C T 16: 44,039,306 (GRCm39) T1262M probably damaging Het
Vcam1 T C 3: 115,914,704 (GRCm39) D316G possibly damaging Het
Vmn2r72 T A 7: 85,400,362 (GRCm39) E229V possibly damaging Het
Zfhx2 T C 14: 55,304,120 (GRCm39) E1288G probably benign Het
Other mutations in Or4c114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Or4c114 APN 2 88,904,545 (GRCm39) missense probably benign 0.04
R0437:Or4c114 UTSW 2 88,904,956 (GRCm39) missense probably benign 0.00
R0653:Or4c114 UTSW 2 88,904,808 (GRCm39) missense possibly damaging 0.90
R1637:Or4c114 UTSW 2 88,905,396 (GRCm39) missense probably damaging 1.00
R1837:Or4c114 UTSW 2 88,905,176 (GRCm39) nonsense probably null
R1906:Or4c114 UTSW 2 88,905,414 (GRCm39) missense possibly damaging 0.93
R2234:Or4c114 UTSW 2 88,904,592 (GRCm39) missense probably damaging 1.00
R2351:Or4c114 UTSW 2 88,904,743 (GRCm39) missense possibly damaging 0.74
R2420:Or4c114 UTSW 2 88,905,336 (GRCm39) missense possibly damaging 0.78
R2421:Or4c114 UTSW 2 88,905,336 (GRCm39) missense possibly damaging 0.78
R3438:Or4c114 UTSW 2 88,904,707 (GRCm39) missense probably benign 0.08
R4470:Or4c114 UTSW 2 88,905,382 (GRCm39) missense probably benign 0.01
R4607:Or4c114 UTSW 2 88,904,656 (GRCm39) missense probably benign 0.08
R4608:Or4c114 UTSW 2 88,904,656 (GRCm39) missense probably benign 0.08
R4693:Or4c114 UTSW 2 88,905,412 (GRCm39) missense possibly damaging 0.69
R5382:Or4c114 UTSW 2 88,905,079 (GRCm39) missense probably damaging 1.00
R5460:Or4c114 UTSW 2 88,905,208 (GRCm39) missense probably benign 0.00
R5504:Or4c114 UTSW 2 88,905,024 (GRCm39) missense probably benign 0.00
R6053:Or4c114 UTSW 2 88,904,898 (GRCm39) missense probably damaging 1.00
R7057:Or4c114 UTSW 2 88,904,808 (GRCm39) missense possibly damaging 0.56
R7323:Or4c114 UTSW 2 88,904,811 (GRCm39) missense probably damaging 0.99
R8229:Or4c114 UTSW 2 88,905,382 (GRCm39) missense possibly damaging 0.88
T0722:Or4c114 UTSW 2 88,905,303 (GRCm39) missense probably benign 0.07
Z1176:Or4c114 UTSW 2 88,904,782 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAAAGCTCTGGTTTTGCATG -3'
(R):5'- ACTCAGACATGGCTCATTCC -3'

Sequencing Primer
(F):5'- AGCTCTGGTTTTGCATGATTCATAAG -3'
(R):5'- TGGCTCATTCCATGAAGAGAC -3'
Posted On 2019-10-24