Incidental Mutation 'R7606:Bcat1'
ID588299
Institutional Source Beutler Lab
Gene Symbol Bcat1
Ensembl Gene ENSMUSG00000030268
Gene Namebranched chain aminotransferase 1, cytosolic
SynonymsEca39, Bcat-1, BCATc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7606 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location144993835-145076184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 145048632 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 46 (H46Q)
Ref Sequence ENSEMBL: ENSMUSP00000032402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000123930] [ENSMUST00000149769] [ENSMUST00000204138]
Predicted Effect probably benign
Transcript: ENSMUST00000032402
AA Change: H46Q

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: H46Q

DomainStartEndE-ValueType
Pfam:Aminotran_4 160 410 1.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048252
SMART Domains Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111742
SMART Domains Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123930
SMART Domains Protein: ENSMUSP00000120180
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2COJ|B 2 224 1e-139 PDB
SCOP:d1ekfa_ 21 224 1e-76 SMART
Blast:FN3 129 192 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149769
SMART Domains Protein: ENSMUSP00000116091
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2ABJ|J 2 136 1e-78 PDB
SCOP:d1ekfa_ 2 136 1e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204138
SMART Domains Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 34 180 9.1e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,036,035 probably null Het
Adat1 T C 8: 111,982,604 K196E possibly damaging Het
Aire T C 10: 78,037,933 D314G probably damaging Het
Atp11a C T 8: 12,844,427 T674I probably damaging Het
Atp8b1 T C 18: 64,555,115 D644G probably damaging Het
Bag4 A G 8: 25,769,305 S289P probably damaging Het
Btg4 A G 9: 51,118,007 N164S probably damaging Het
Ccz1 G A 5: 144,014,808 A2V probably benign Het
Cd209g T C 8: 4,136,839 L128P probably damaging Het
Col4a2 T A 8: 11,443,571 M1380K probably benign Het
Cpox T C 16: 58,674,449 V283A probably benign Het
Dnah10 A T 5: 124,817,712 D3504V probably benign Het
Eml1 A T 12: 108,537,366 I741F probably benign Het
Fam171a2 A G 11: 102,444,176 V45A possibly damaging Het
Fem1a A G 17: 56,256,946 D13G probably damaging Het
Fkbp14 A G 6: 54,593,018 I9T probably benign Het
Golt1b G A 6: 142,392,342 G13D probably damaging Het
Heatr5b T C 17: 78,763,026 N1653D probably benign Het
Hrg A G 16: 22,951,123 M1V probably null Het
Itgb2 T A 10: 77,556,161 I356N probably damaging Het
Kcnb2 A G 1: 15,312,840 E130G probably damaging Het
Kpna2 A T 11: 106,992,058 F124Y probably damaging Het
Lyst T C 13: 13,637,475 I824T probably damaging Het
Meis2 T C 2: 116,063,320 H38R possibly damaging Het
Mknk1 T G 4: 115,877,994 I353S probably damaging Het
Mrc1 T A 2: 14,238,144 I27N probably damaging Het
Mup4 T C 4: 59,958,568 T111A probably damaging Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Neb T G 2: 52,226,444 E994A Het
Nlrc5 T C 8: 94,477,117 M615T possibly damaging Het
Nup88 T C 11: 70,961,615 E218G possibly damaging Het
Olfr1219 A G 2: 89,075,297 probably benign Het
Olfr1513 A T 14: 52,349,963 F28I probably benign Het
Parp11 A G 6: 127,470,760 D19G probably benign Het
Parp2 A T 14: 50,820,030 T429S probably damaging Het
Pcdhb6 G A 18: 37,335,606 E527K probably damaging Het
Pde8a A G 7: 81,332,967 Y778C probably damaging Het
Pea15a T C 1: 172,200,583 probably null Het
Plcd3 A G 11: 103,076,857 Y420H probably damaging Het
Ppp1ca C A 19: 4,193,089 S85R possibly damaging Het
Pth A C 7: 113,386,243 I13S probably benign Het
Rbm27 A G 18: 42,327,513 T842A probably damaging Het
Rcbtb2 T A 14: 73,182,366 probably null Het
Rubcnl C T 14: 75,038,874 L323F probably benign Het
Ryr3 A T 2: 112,645,245 Y4539* probably null Het
Scamp3 T A 3: 89,181,218 F244I probably damaging Het
Sema4d T C 13: 51,723,622 D58G probably benign Het
Skor1 G T 9: 63,145,382 A435E probably damaging Het
Slc35a4 A G 18: 36,682,585 Y156C probably benign Het
Spryd7 T C 14: 61,540,158 T158A possibly damaging Het
Srgap3 A C 6: 112,739,376 I621S probably benign Het
Tbc1d31 A G 15: 57,951,670 E581G probably damaging Het
Tcf4 C T 18: 69,642,983 T318I probably damaging Het
Usf3 C T 16: 44,218,943 T1262M probably damaging Het
Vcam1 T C 3: 116,121,055 D316G possibly damaging Het
Vmn2r72 T A 7: 85,751,154 E229V possibly damaging Het
Zfhx2 T C 14: 55,066,663 E1288G probably benign Het
Other mutations in Bcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcat1 APN 6 145000289 missense possibly damaging 0.89
IGL01882:Bcat1 APN 6 145004409 missense probably damaging 1.00
IGL02021:Bcat1 APN 6 145047289 splice site probably benign
IGL02024:Bcat1 APN 6 145032838 missense probably damaging 0.97
IGL02705:Bcat1 APN 6 145019188 splice site probably benign
IGL02954:Bcat1 APN 6 145019219 missense probably damaging 1.00
R0331:Bcat1 UTSW 6 145047314 missense probably benign 0.17
R1592:Bcat1 UTSW 6 145010058 missense probably benign 0.00
R1680:Bcat1 UTSW 6 145039628 missense probably damaging 1.00
R2162:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R2306:Bcat1 UTSW 6 145007653 missense probably damaging 0.96
R3498:Bcat1 UTSW 6 145019342 missense probably damaging 0.99
R3758:Bcat1 UTSW 6 145032872 missense probably damaging 1.00
R3831:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R3833:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R4829:Bcat1 UTSW 6 145015475 missense probably damaging 1.00
R5250:Bcat1 UTSW 6 145047439 critical splice donor site probably null
R5338:Bcat1 UTSW 6 145007627 missense possibly damaging 0.50
R5414:Bcat1 UTSW 6 145015447 critical splice donor site probably null
R5679:Bcat1 UTSW 6 145007748 missense probably damaging 1.00
R6566:Bcat1 UTSW 6 145015484 missense probably damaging 1.00
R7015:Bcat1 UTSW 6 145039583 missense probably damaging 0.99
R7255:Bcat1 UTSW 6 145032785 nonsense probably null
R8115:Bcat1 UTSW 6 145010093 missense probably damaging 1.00
RF004:Bcat1 UTSW 6 145007623 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCGGTAATACCCAAGAGC -3'
(R):5'- TCCTTAGTAAAGTGCGGGTGC -3'

Sequencing Primer
(F):5'- CGGTAATACCCAAGAGCCTAGTG -3'
(R):5'- AAAGTGCGGGTGCTCCTGAG -3'
Posted On2019-10-24