Incidental Mutation 'R7606:Bcat1'
ID 588299
Institutional Source Beutler Lab
Gene Symbol Bcat1
Ensembl Gene ENSMUSG00000030268
Gene Name branched chain aminotransferase 1, cytosolic
Synonyms Eca39, BCATc, Bcat-1
MMRRC Submission 045676-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R7606 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 144939561-145021883 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 144994358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 46 (H46Q)
Ref Sequence ENSEMBL: ENSMUSP00000032402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000123930] [ENSMUST00000149769] [ENSMUST00000204138]
AlphaFold P24288
Predicted Effect probably benign
Transcript: ENSMUST00000032402
AA Change: H46Q

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: H46Q

DomainStartEndE-ValueType
Pfam:Aminotran_4 160 410 1.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048252
SMART Domains Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111742
SMART Domains Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123930
SMART Domains Protein: ENSMUSP00000120180
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2COJ|B 2 224 1e-139 PDB
SCOP:d1ekfa_ 21 224 1e-76 SMART
Blast:FN3 129 192 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149769
SMART Domains Protein: ENSMUSP00000116091
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2ABJ|J 2 136 1e-78 PDB
SCOP:d1ekfa_ 2 136 1e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204138
SMART Domains Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 34 180 9.1e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 59,943,456 (GRCm39) probably null Het
Adat1 T C 8: 112,709,236 (GRCm39) K196E possibly damaging Het
Aire T C 10: 77,873,767 (GRCm39) D314G probably damaging Het
Atp11a C T 8: 12,894,427 (GRCm39) T674I probably damaging Het
Atp8b1 T C 18: 64,688,186 (GRCm39) D644G probably damaging Het
Bag4 A G 8: 26,259,333 (GRCm39) S289P probably damaging Het
Btg4 A G 9: 51,029,307 (GRCm39) N164S probably damaging Het
Ccz1 G A 5: 143,951,626 (GRCm39) A2V probably benign Het
Cd209g T C 8: 4,186,839 (GRCm39) L128P probably damaging Het
Col4a2 T A 8: 11,493,571 (GRCm39) M1380K probably benign Het
Cpox T C 16: 58,494,812 (GRCm39) V283A probably benign Het
Dnah10 A T 5: 124,894,776 (GRCm39) D3504V probably benign Het
Eml1 A T 12: 108,503,625 (GRCm39) I741F probably benign Het
Fam171a2 A G 11: 102,335,002 (GRCm39) V45A possibly damaging Het
Fem1a A G 17: 56,563,946 (GRCm39) D13G probably damaging Het
Fkbp14 A G 6: 54,570,003 (GRCm39) I9T probably benign Het
Golt1b G A 6: 142,338,068 (GRCm39) G13D probably damaging Het
Heatr5b T C 17: 79,070,455 (GRCm39) N1653D probably benign Het
Hrg A G 16: 22,769,873 (GRCm39) M1V probably null Het
Itgb2 T A 10: 77,391,995 (GRCm39) I356N probably damaging Het
Kcnb2 A G 1: 15,383,064 (GRCm39) E130G probably damaging Het
Kpna2 A T 11: 106,882,884 (GRCm39) F124Y probably damaging Het
Lyst T C 13: 13,812,060 (GRCm39) I824T probably damaging Het
Meis2 T C 2: 115,893,801 (GRCm39) H38R possibly damaging Het
Mknk1 T G 4: 115,735,191 (GRCm39) I353S probably damaging Het
Mrc1 T A 2: 14,242,955 (GRCm39) I27N probably damaging Het
Mup4 T C 4: 59,958,568 (GRCm39) T111A probably damaging Het
Myo1f T C 17: 33,795,424 (GRCm39) V53A probably damaging Het
Neb T G 2: 52,116,456 (GRCm39) E994A Het
Nlrc5 T C 8: 95,203,745 (GRCm39) M615T possibly damaging Het
Nup88 T C 11: 70,852,441 (GRCm39) E218G possibly damaging Het
Or10g3b A T 14: 52,587,420 (GRCm39) F28I probably benign Het
Or4c114 A G 2: 88,905,641 (GRCm39) probably benign Het
Parp11 A G 6: 127,447,723 (GRCm39) D19G probably benign Het
Parp2 A T 14: 51,057,487 (GRCm39) T429S probably damaging Het
Pcdhb6 G A 18: 37,468,659 (GRCm39) E527K probably damaging Het
Pde8a A G 7: 80,982,715 (GRCm39) Y778C probably damaging Het
Pea15a T C 1: 172,028,150 (GRCm39) probably null Het
Plcd3 A G 11: 102,967,683 (GRCm39) Y420H probably damaging Het
Ppp1ca C A 19: 4,243,088 (GRCm39) S85R possibly damaging Het
Pth A C 7: 112,985,450 (GRCm39) I13S probably benign Het
Rbm27 A G 18: 42,460,578 (GRCm39) T842A probably damaging Het
Rcbtb2 T A 14: 73,419,806 (GRCm39) probably null Het
Rubcnl C T 14: 75,276,314 (GRCm39) L323F probably benign Het
Ryr3 A T 2: 112,475,590 (GRCm39) Y4539* probably null Het
Scamp3 T A 3: 89,088,525 (GRCm39) F244I probably damaging Het
Sema4d T C 13: 51,877,658 (GRCm39) D58G probably benign Het
Skor1 G T 9: 63,052,664 (GRCm39) A435E probably damaging Het
Slc35a4 A G 18: 36,815,638 (GRCm39) Y156C probably benign Het
Spryd7 T C 14: 61,777,607 (GRCm39) T158A possibly damaging Het
Srgap3 A C 6: 112,716,337 (GRCm39) I621S probably benign Het
Tbc1d31 A G 15: 57,815,066 (GRCm39) E581G probably damaging Het
Tcf4 C T 18: 69,776,054 (GRCm39) T318I probably damaging Het
Usf3 C T 16: 44,039,306 (GRCm39) T1262M probably damaging Het
Vcam1 T C 3: 115,914,704 (GRCm39) D316G possibly damaging Het
Vmn2r72 T A 7: 85,400,362 (GRCm39) E229V possibly damaging Het
Zfhx2 T C 14: 55,304,120 (GRCm39) E1288G probably benign Het
Other mutations in Bcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcat1 APN 6 144,946,015 (GRCm39) missense possibly damaging 0.89
IGL01882:Bcat1 APN 6 144,950,135 (GRCm39) missense probably damaging 1.00
IGL02021:Bcat1 APN 6 144,993,015 (GRCm39) splice site probably benign
IGL02024:Bcat1 APN 6 144,978,564 (GRCm39) missense probably damaging 0.97
IGL02705:Bcat1 APN 6 144,964,914 (GRCm39) splice site probably benign
IGL02954:Bcat1 APN 6 144,964,945 (GRCm39) missense probably damaging 1.00
R0331:Bcat1 UTSW 6 144,993,040 (GRCm39) missense probably benign 0.17
R1592:Bcat1 UTSW 6 144,955,784 (GRCm39) missense probably benign 0.00
R1680:Bcat1 UTSW 6 144,985,354 (GRCm39) missense probably damaging 1.00
R2162:Bcat1 UTSW 6 144,955,834 (GRCm39) missense probably damaging 1.00
R2306:Bcat1 UTSW 6 144,953,379 (GRCm39) missense probably damaging 0.96
R3498:Bcat1 UTSW 6 144,965,068 (GRCm39) missense probably damaging 0.99
R3758:Bcat1 UTSW 6 144,978,598 (GRCm39) missense probably damaging 1.00
R3831:Bcat1 UTSW 6 144,955,834 (GRCm39) missense probably damaging 1.00
R3833:Bcat1 UTSW 6 144,955,834 (GRCm39) missense probably damaging 1.00
R4829:Bcat1 UTSW 6 144,961,201 (GRCm39) missense probably damaging 1.00
R5250:Bcat1 UTSW 6 144,993,165 (GRCm39) critical splice donor site probably null
R5338:Bcat1 UTSW 6 144,953,353 (GRCm39) missense possibly damaging 0.50
R5414:Bcat1 UTSW 6 144,961,173 (GRCm39) critical splice donor site probably null
R5679:Bcat1 UTSW 6 144,953,474 (GRCm39) missense probably damaging 1.00
R6566:Bcat1 UTSW 6 144,961,210 (GRCm39) missense probably damaging 1.00
R7015:Bcat1 UTSW 6 144,985,309 (GRCm39) missense probably damaging 0.99
R7255:Bcat1 UTSW 6 144,978,511 (GRCm39) nonsense probably null
R8115:Bcat1 UTSW 6 144,955,819 (GRCm39) missense probably damaging 1.00
R9198:Bcat1 UTSW 6 144,985,222 (GRCm39) missense probably damaging 1.00
R9342:Bcat1 UTSW 6 144,994,332 (GRCm39) missense probably benign
R9588:Bcat1 UTSW 6 144,950,126 (GRCm39) missense probably benign 0.04
R9665:Bcat1 UTSW 6 144,994,488 (GRCm39) missense probably benign
RF004:Bcat1 UTSW 6 144,953,349 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCGGTAATACCCAAGAGC -3'
(R):5'- TCCTTAGTAAAGTGCGGGTGC -3'

Sequencing Primer
(F):5'- CGGTAATACCCAAGAGCCTAGTG -3'
(R):5'- AAAGTGCGGGTGCTCCTGAG -3'
Posted On 2019-10-24