Incidental Mutation 'R7606:Vmn2r72'
ID588301
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7606 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85751154 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 229 (E229V)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063425
AA Change: E229V

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: E229V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,036,035 probably null Het
Adat1 T C 8: 111,982,604 K196E possibly damaging Het
Aire T C 10: 78,037,933 D314G probably damaging Het
Atp11a C T 8: 12,844,427 T674I probably damaging Het
Atp8b1 T C 18: 64,555,115 D644G probably damaging Het
Bag4 A G 8: 25,769,305 S289P probably damaging Het
Bcat1 G T 6: 145,048,632 H46Q probably benign Het
Btg4 A G 9: 51,118,007 N164S probably damaging Het
Ccz1 G A 5: 144,014,808 A2V probably benign Het
Cd209g T C 8: 4,136,839 L128P probably damaging Het
Col4a2 T A 8: 11,443,571 M1380K probably benign Het
Cpox T C 16: 58,674,449 V283A probably benign Het
Dnah10 A T 5: 124,817,712 D3504V probably benign Het
Eml1 A T 12: 108,537,366 I741F probably benign Het
Fam171a2 A G 11: 102,444,176 V45A possibly damaging Het
Fem1a A G 17: 56,256,946 D13G probably damaging Het
Fkbp14 A G 6: 54,593,018 I9T probably benign Het
Golt1b G A 6: 142,392,342 G13D probably damaging Het
Heatr5b T C 17: 78,763,026 N1653D probably benign Het
Hrg A G 16: 22,951,123 M1V probably null Het
Itgb2 T A 10: 77,556,161 I356N probably damaging Het
Kcnb2 A G 1: 15,312,840 E130G probably damaging Het
Kpna2 A T 11: 106,992,058 F124Y probably damaging Het
Lyst T C 13: 13,637,475 I824T probably damaging Het
Meis2 T C 2: 116,063,320 H38R possibly damaging Het
Mknk1 T G 4: 115,877,994 I353S probably damaging Het
Mrc1 T A 2: 14,238,144 I27N probably damaging Het
Mup4 T C 4: 59,958,568 T111A probably damaging Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Neb T G 2: 52,226,444 E994A Het
Nlrc5 T C 8: 94,477,117 M615T possibly damaging Het
Nup88 T C 11: 70,961,615 E218G possibly damaging Het
Olfr1219 A G 2: 89,075,297 probably benign Het
Olfr1513 A T 14: 52,349,963 F28I probably benign Het
Parp11 A G 6: 127,470,760 D19G probably benign Het
Parp2 A T 14: 50,820,030 T429S probably damaging Het
Pcdhb6 G A 18: 37,335,606 E527K probably damaging Het
Pde8a A G 7: 81,332,967 Y778C probably damaging Het
Pea15a T C 1: 172,200,583 probably null Het
Plcd3 A G 11: 103,076,857 Y420H probably damaging Het
Ppp1ca C A 19: 4,193,089 S85R possibly damaging Het
Pth A C 7: 113,386,243 I13S probably benign Het
Rbm27 A G 18: 42,327,513 T842A probably damaging Het
Rcbtb2 T A 14: 73,182,366 probably null Het
Rubcnl C T 14: 75,038,874 L323F probably benign Het
Ryr3 A T 2: 112,645,245 Y4539* probably null Het
Scamp3 T A 3: 89,181,218 F244I probably damaging Het
Sema4d T C 13: 51,723,622 D58G probably benign Het
Skor1 G T 9: 63,145,382 A435E probably damaging Het
Slc35a4 A G 18: 36,682,585 Y156C probably benign Het
Spryd7 T C 14: 61,540,158 T158A possibly damaging Het
Srgap3 A C 6: 112,739,376 I621S probably benign Het
Tbc1d31 A G 15: 57,951,670 E581G probably damaging Het
Tcf4 C T 18: 69,642,983 T318I probably damaging Het
Usf3 C T 16: 44,218,943 T1262M probably damaging Het
Vcam1 T C 3: 116,121,055 D316G possibly damaging Het
Zfhx2 T C 14: 55,066,663 E1288G probably benign Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTTTTGATTTAAACCAATGGAGG -3'
(R):5'- GCTAAAGCACACTCTACATCATGTTC -3'

Sequencing Primer
(F):5'- TTTAAACCAATGGAGGACAAGATC -3'
(R):5'- AGCTTTACTGCGGTCATTTTC -3'
Posted On2019-10-24