Incidental Mutation 'R7606:Fam171a2'
ID 588315
Institutional Source Beutler Lab
Gene Symbol Fam171a2
Ensembl Gene ENSMUSG00000034685
Gene Name family with sequence similarity 171, member A2
Synonyms
MMRRC Submission 045676-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R7606 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102327807-102338508 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102335002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Ref Sequence ENSEMBL: ENSMUSP00000038486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057]
AlphaFold A2A699
Predicted Effect possibly damaging
Transcript: ENSMUST00000049057
AA Change: V45A

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685
AA Change: V45A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Meta Mutation Damage Score 0.6121 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 59,943,456 (GRCm39) probably null Het
Adat1 T C 8: 112,709,236 (GRCm39) K196E possibly damaging Het
Aire T C 10: 77,873,767 (GRCm39) D314G probably damaging Het
Atp11a C T 8: 12,894,427 (GRCm39) T674I probably damaging Het
Atp8b1 T C 18: 64,688,186 (GRCm39) D644G probably damaging Het
Bag4 A G 8: 26,259,333 (GRCm39) S289P probably damaging Het
Bcat1 G T 6: 144,994,358 (GRCm39) H46Q probably benign Het
Btg4 A G 9: 51,029,307 (GRCm39) N164S probably damaging Het
Ccz1 G A 5: 143,951,626 (GRCm39) A2V probably benign Het
Cd209g T C 8: 4,186,839 (GRCm39) L128P probably damaging Het
Col4a2 T A 8: 11,493,571 (GRCm39) M1380K probably benign Het
Cpox T C 16: 58,494,812 (GRCm39) V283A probably benign Het
Dnah10 A T 5: 124,894,776 (GRCm39) D3504V probably benign Het
Eml1 A T 12: 108,503,625 (GRCm39) I741F probably benign Het
Fem1a A G 17: 56,563,946 (GRCm39) D13G probably damaging Het
Fkbp14 A G 6: 54,570,003 (GRCm39) I9T probably benign Het
Golt1b G A 6: 142,338,068 (GRCm39) G13D probably damaging Het
Heatr5b T C 17: 79,070,455 (GRCm39) N1653D probably benign Het
Hrg A G 16: 22,769,873 (GRCm39) M1V probably null Het
Itgb2 T A 10: 77,391,995 (GRCm39) I356N probably damaging Het
Kcnb2 A G 1: 15,383,064 (GRCm39) E130G probably damaging Het
Kpna2 A T 11: 106,882,884 (GRCm39) F124Y probably damaging Het
Lyst T C 13: 13,812,060 (GRCm39) I824T probably damaging Het
Meis2 T C 2: 115,893,801 (GRCm39) H38R possibly damaging Het
Mknk1 T G 4: 115,735,191 (GRCm39) I353S probably damaging Het
Mrc1 T A 2: 14,242,955 (GRCm39) I27N probably damaging Het
Mup4 T C 4: 59,958,568 (GRCm39) T111A probably damaging Het
Myo1f T C 17: 33,795,424 (GRCm39) V53A probably damaging Het
Neb T G 2: 52,116,456 (GRCm39) E994A Het
Nlrc5 T C 8: 95,203,745 (GRCm39) M615T possibly damaging Het
Nup88 T C 11: 70,852,441 (GRCm39) E218G possibly damaging Het
Or10g3b A T 14: 52,587,420 (GRCm39) F28I probably benign Het
Or4c114 A G 2: 88,905,641 (GRCm39) probably benign Het
Parp11 A G 6: 127,447,723 (GRCm39) D19G probably benign Het
Parp2 A T 14: 51,057,487 (GRCm39) T429S probably damaging Het
Pcdhb6 G A 18: 37,468,659 (GRCm39) E527K probably damaging Het
Pde8a A G 7: 80,982,715 (GRCm39) Y778C probably damaging Het
Pea15a T C 1: 172,028,150 (GRCm39) probably null Het
Plcd3 A G 11: 102,967,683 (GRCm39) Y420H probably damaging Het
Ppp1ca C A 19: 4,243,088 (GRCm39) S85R possibly damaging Het
Pth A C 7: 112,985,450 (GRCm39) I13S probably benign Het
Rbm27 A G 18: 42,460,578 (GRCm39) T842A probably damaging Het
Rcbtb2 T A 14: 73,419,806 (GRCm39) probably null Het
Rubcnl C T 14: 75,276,314 (GRCm39) L323F probably benign Het
Ryr3 A T 2: 112,475,590 (GRCm39) Y4539* probably null Het
Scamp3 T A 3: 89,088,525 (GRCm39) F244I probably damaging Het
Sema4d T C 13: 51,877,658 (GRCm39) D58G probably benign Het
Skor1 G T 9: 63,052,664 (GRCm39) A435E probably damaging Het
Slc35a4 A G 18: 36,815,638 (GRCm39) Y156C probably benign Het
Spryd7 T C 14: 61,777,607 (GRCm39) T158A possibly damaging Het
Srgap3 A C 6: 112,716,337 (GRCm39) I621S probably benign Het
Tbc1d31 A G 15: 57,815,066 (GRCm39) E581G probably damaging Het
Tcf4 C T 18: 69,776,054 (GRCm39) T318I probably damaging Het
Usf3 C T 16: 44,039,306 (GRCm39) T1262M probably damaging Het
Vcam1 T C 3: 115,914,704 (GRCm39) D316G possibly damaging Het
Vmn2r72 T A 7: 85,400,362 (GRCm39) E229V possibly damaging Het
Zfhx2 T C 14: 55,304,120 (GRCm39) E1288G probably benign Het
Other mutations in Fam171a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Fam171a2 APN 11 102,328,674 (GRCm39) missense possibly damaging 0.92
IGL01898:Fam171a2 APN 11 102,330,582 (GRCm39) missense possibly damaging 0.88
IGL02477:Fam171a2 APN 11 102,330,854 (GRCm39) missense probably benign 0.00
IGL03272:Fam171a2 APN 11 102,334,944 (GRCm39) missense possibly damaging 0.58
R0102:Fam171a2 UTSW 11 102,334,939 (GRCm39) missense possibly damaging 0.88
R0102:Fam171a2 UTSW 11 102,334,939 (GRCm39) missense possibly damaging 0.88
R0632:Fam171a2 UTSW 11 102,328,707 (GRCm39) missense probably damaging 0.99
R0733:Fam171a2 UTSW 11 102,330,548 (GRCm39) missense possibly damaging 0.83
R1005:Fam171a2 UTSW 11 102,331,007 (GRCm39) missense probably benign 0.05
R1323:Fam171a2 UTSW 11 102,334,951 (GRCm39) missense probably damaging 0.99
R1323:Fam171a2 UTSW 11 102,334,951 (GRCm39) missense probably damaging 0.99
R2425:Fam171a2 UTSW 11 102,329,187 (GRCm39) missense possibly damaging 0.88
R4838:Fam171a2 UTSW 11 102,329,511 (GRCm39) missense possibly damaging 0.88
R4858:Fam171a2 UTSW 11 102,330,982 (GRCm39) missense probably damaging 1.00
R5119:Fam171a2 UTSW 11 102,329,559 (GRCm39) missense probably damaging 0.97
R5384:Fam171a2 UTSW 11 102,328,693 (GRCm39) missense possibly damaging 0.51
R5386:Fam171a2 UTSW 11 102,328,693 (GRCm39) missense possibly damaging 0.51
R5408:Fam171a2 UTSW 11 102,328,344 (GRCm39) missense possibly damaging 0.71
R5457:Fam171a2 UTSW 11 102,328,362 (GRCm39) missense possibly damaging 0.92
R5732:Fam171a2 UTSW 11 102,330,807 (GRCm39) missense possibly damaging 0.94
R6466:Fam171a2 UTSW 11 102,330,711 (GRCm39) missense probably damaging 1.00
R6931:Fam171a2 UTSW 11 102,329,260 (GRCm39) missense possibly damaging 0.95
R7196:Fam171a2 UTSW 11 102,329,172 (GRCm39) missense probably benign 0.04
R7261:Fam171a2 UTSW 11 102,328,900 (GRCm39) missense probably damaging 0.98
R7295:Fam171a2 UTSW 11 102,329,064 (GRCm39) missense possibly damaging 0.85
R7419:Fam171a2 UTSW 11 102,329,628 (GRCm39) missense possibly damaging 0.95
R7422:Fam171a2 UTSW 11 102,329,491 (GRCm39) missense probably benign 0.29
R7454:Fam171a2 UTSW 11 102,330,543 (GRCm39) missense possibly damaging 0.88
R7690:Fam171a2 UTSW 11 102,328,660 (GRCm39) missense probably benign 0.04
R7754:Fam171a2 UTSW 11 102,329,389 (GRCm39) missense probably benign 0.00
R7970:Fam171a2 UTSW 11 102,328,692 (GRCm39) missense possibly damaging 0.93
R8060:Fam171a2 UTSW 11 102,329,436 (GRCm39) missense possibly damaging 0.88
R8338:Fam171a2 UTSW 11 102,329,172 (GRCm39) missense probably benign 0.10
R8924:Fam171a2 UTSW 11 102,330,861 (GRCm39) missense possibly damaging 0.94
R8976:Fam171a2 UTSW 11 102,329,451 (GRCm39) missense possibly damaging 0.46
R9116:Fam171a2 UTSW 11 102,330,519 (GRCm39) missense probably damaging 0.98
R9155:Fam171a2 UTSW 11 102,329,497 (GRCm39) missense probably benign 0.28
R9346:Fam171a2 UTSW 11 102,328,771 (GRCm39) missense possibly damaging 0.87
Z1176:Fam171a2 UTSW 11 102,338,272 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGAGTTGGTGAGGAAACC -3'
(R):5'- TAGAATTGTGAAAGTATGCATGGGC -3'

Sequencing Primer
(F):5'- TTGGTGAGGAAACCGGGGC -3'
(R):5'- AGTATGCATGGGCTAGCGC -3'
Posted On 2019-10-24