Incidental Mutation 'R7606:Plcd3'
ID 588316
Institutional Source Beutler Lab
Gene Symbol Plcd3
Ensembl Gene ENSMUSG00000020937
Gene Name phospholipase C, delta 3
Synonyms 2610205J15Rik
MMRRC Submission 045676-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.723) question?
Stock # R7606 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102961130-102992484 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102967683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 420 (Y420H)
Ref Sequence ENSEMBL: ENSMUSP00000099366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103077]
AlphaFold Q8K2J0
Predicted Effect probably damaging
Transcript: ENSMUST00000103077
AA Change: Y420H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099366
Gene: ENSMUSG00000020937
AA Change: Y420H

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
PH 61 170 4.07e-5 SMART
Pfam:EF-hand_10 197 246 1.8e-27 PFAM
Pfam:EF-hand_like 251 332 2.6e-24 PFAM
PLCXc 333 478 7.75e-85 SMART
low complexity region 495 512 N/A INTRINSIC
PLCYc 524 640 3.96e-50 SMART
C2 657 763 1.05e-14 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117455
Gene: ENSMUSG00000020937
AA Change: Y105H

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
PLCXc 19 164 7.75e-85 SMART
coiled coil region 172 206 N/A INTRINSIC
PLCYc 210 326 3.96e-50 SMART
C2 343 449 1.05e-14 SMART
Meta Mutation Damage Score 0.6543 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 59,943,456 (GRCm39) probably null Het
Adat1 T C 8: 112,709,236 (GRCm39) K196E possibly damaging Het
Aire T C 10: 77,873,767 (GRCm39) D314G probably damaging Het
Atp11a C T 8: 12,894,427 (GRCm39) T674I probably damaging Het
Atp8b1 T C 18: 64,688,186 (GRCm39) D644G probably damaging Het
Bag4 A G 8: 26,259,333 (GRCm39) S289P probably damaging Het
Bcat1 G T 6: 144,994,358 (GRCm39) H46Q probably benign Het
Btg4 A G 9: 51,029,307 (GRCm39) N164S probably damaging Het
Ccz1 G A 5: 143,951,626 (GRCm39) A2V probably benign Het
Cd209g T C 8: 4,186,839 (GRCm39) L128P probably damaging Het
Col4a2 T A 8: 11,493,571 (GRCm39) M1380K probably benign Het
Cpox T C 16: 58,494,812 (GRCm39) V283A probably benign Het
Dnah10 A T 5: 124,894,776 (GRCm39) D3504V probably benign Het
Eml1 A T 12: 108,503,625 (GRCm39) I741F probably benign Het
Fam171a2 A G 11: 102,335,002 (GRCm39) V45A possibly damaging Het
Fem1a A G 17: 56,563,946 (GRCm39) D13G probably damaging Het
Fkbp14 A G 6: 54,570,003 (GRCm39) I9T probably benign Het
Golt1b G A 6: 142,338,068 (GRCm39) G13D probably damaging Het
Heatr5b T C 17: 79,070,455 (GRCm39) N1653D probably benign Het
Hrg A G 16: 22,769,873 (GRCm39) M1V probably null Het
Itgb2 T A 10: 77,391,995 (GRCm39) I356N probably damaging Het
Kcnb2 A G 1: 15,383,064 (GRCm39) E130G probably damaging Het
Kpna2 A T 11: 106,882,884 (GRCm39) F124Y probably damaging Het
Lyst T C 13: 13,812,060 (GRCm39) I824T probably damaging Het
Meis2 T C 2: 115,893,801 (GRCm39) H38R possibly damaging Het
Mknk1 T G 4: 115,735,191 (GRCm39) I353S probably damaging Het
Mrc1 T A 2: 14,242,955 (GRCm39) I27N probably damaging Het
Mup4 T C 4: 59,958,568 (GRCm39) T111A probably damaging Het
Myo1f T C 17: 33,795,424 (GRCm39) V53A probably damaging Het
Neb T G 2: 52,116,456 (GRCm39) E994A Het
Nlrc5 T C 8: 95,203,745 (GRCm39) M615T possibly damaging Het
Nup88 T C 11: 70,852,441 (GRCm39) E218G possibly damaging Het
Or10g3b A T 14: 52,587,420 (GRCm39) F28I probably benign Het
Or4c114 A G 2: 88,905,641 (GRCm39) probably benign Het
Parp11 A G 6: 127,447,723 (GRCm39) D19G probably benign Het
Parp2 A T 14: 51,057,487 (GRCm39) T429S probably damaging Het
Pcdhb6 G A 18: 37,468,659 (GRCm39) E527K probably damaging Het
Pde8a A G 7: 80,982,715 (GRCm39) Y778C probably damaging Het
Pea15a T C 1: 172,028,150 (GRCm39) probably null Het
Ppp1ca C A 19: 4,243,088 (GRCm39) S85R possibly damaging Het
Pth A C 7: 112,985,450 (GRCm39) I13S probably benign Het
Rbm27 A G 18: 42,460,578 (GRCm39) T842A probably damaging Het
Rcbtb2 T A 14: 73,419,806 (GRCm39) probably null Het
Rubcnl C T 14: 75,276,314 (GRCm39) L323F probably benign Het
Ryr3 A T 2: 112,475,590 (GRCm39) Y4539* probably null Het
Scamp3 T A 3: 89,088,525 (GRCm39) F244I probably damaging Het
Sema4d T C 13: 51,877,658 (GRCm39) D58G probably benign Het
Skor1 G T 9: 63,052,664 (GRCm39) A435E probably damaging Het
Slc35a4 A G 18: 36,815,638 (GRCm39) Y156C probably benign Het
Spryd7 T C 14: 61,777,607 (GRCm39) T158A possibly damaging Het
Srgap3 A C 6: 112,716,337 (GRCm39) I621S probably benign Het
Tbc1d31 A G 15: 57,815,066 (GRCm39) E581G probably damaging Het
Tcf4 C T 18: 69,776,054 (GRCm39) T318I probably damaging Het
Usf3 C T 16: 44,039,306 (GRCm39) T1262M probably damaging Het
Vcam1 T C 3: 115,914,704 (GRCm39) D316G possibly damaging Het
Vmn2r72 T A 7: 85,400,362 (GRCm39) E229V possibly damaging Het
Zfhx2 T C 14: 55,304,120 (GRCm39) E1288G probably benign Het
Other mutations in Plcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Plcd3 APN 11 102,968,696 (GRCm39) missense probably benign 0.16
IGL01906:Plcd3 APN 11 102,967,682 (GRCm39) missense probably damaging 1.00
IGL02325:Plcd3 APN 11 102,971,447 (GRCm39) nonsense probably null
IGL02634:Plcd3 APN 11 102,968,653 (GRCm39) missense probably damaging 1.00
IGL02852:Plcd3 APN 11 102,964,631 (GRCm39) missense probably damaging 1.00
IGL03025:Plcd3 APN 11 102,965,724 (GRCm39) missense probably benign 0.24
IGL02837:Plcd3 UTSW 11 102,961,929 (GRCm39) missense possibly damaging 0.92
IGL02988:Plcd3 UTSW 11 102,967,568 (GRCm39) missense probably benign
R0055:Plcd3 UTSW 11 102,968,411 (GRCm39) missense probably damaging 1.00
R0055:Plcd3 UTSW 11 102,968,411 (GRCm39) missense probably damaging 1.00
R0062:Plcd3 UTSW 11 102,965,720 (GRCm39) missense probably benign
R0452:Plcd3 UTSW 11 102,962,085 (GRCm39) unclassified probably benign
R0529:Plcd3 UTSW 11 102,971,013 (GRCm39) missense probably benign 0.00
R0556:Plcd3 UTSW 11 102,968,632 (GRCm39) missense probably damaging 1.00
R1463:Plcd3 UTSW 11 102,969,199 (GRCm39) missense probably damaging 1.00
R1752:Plcd3 UTSW 11 102,971,085 (GRCm39) missense probably benign 0.01
R2157:Plcd3 UTSW 11 102,961,974 (GRCm39) missense probably benign
R2519:Plcd3 UTSW 11 102,971,226 (GRCm39) missense possibly damaging 0.80
R3809:Plcd3 UTSW 11 102,992,209 (GRCm39) missense probably null 0.03
R4167:Plcd3 UTSW 11 102,969,290 (GRCm39) missense probably damaging 0.98
R5100:Plcd3 UTSW 11 102,969,175 (GRCm39) missense probably benign
R5387:Plcd3 UTSW 11 102,969,281 (GRCm39) missense probably damaging 1.00
R5589:Plcd3 UTSW 11 102,968,629 (GRCm39) missense probably benign 0.01
R5700:Plcd3 UTSW 11 102,964,589 (GRCm39) missense probably benign 0.00
R5754:Plcd3 UTSW 11 102,964,592 (GRCm39) missense possibly damaging 0.67
R5936:Plcd3 UTSW 11 102,969,173 (GRCm39) missense probably damaging 1.00
R6059:Plcd3 UTSW 11 102,971,227 (GRCm39) missense possibly damaging 0.80
R6102:Plcd3 UTSW 11 102,971,470 (GRCm39) missense probably damaging 0.99
R6480:Plcd3 UTSW 11 102,965,757 (GRCm39) missense possibly damaging 0.79
R6481:Plcd3 UTSW 11 102,968,593 (GRCm39) missense probably damaging 1.00
R6566:Plcd3 UTSW 11 102,964,626 (GRCm39) missense probably damaging 1.00
R7098:Plcd3 UTSW 11 102,968,689 (GRCm39) missense probably damaging 1.00
R7165:Plcd3 UTSW 11 102,970,439 (GRCm39) missense probably damaging 1.00
R7392:Plcd3 UTSW 11 102,992,383 (GRCm39) unclassified probably benign
R7484:Plcd3 UTSW 11 102,962,545 (GRCm39) missense probably damaging 1.00
R7777:Plcd3 UTSW 11 102,965,481 (GRCm39) missense probably benign 0.33
R7857:Plcd3 UTSW 11 102,968,760 (GRCm39) missense probably benign 0.12
R8349:Plcd3 UTSW 11 102,965,496 (GRCm39) missense probably damaging 1.00
R8449:Plcd3 UTSW 11 102,965,496 (GRCm39) missense probably damaging 1.00
R8786:Plcd3 UTSW 11 102,962,569 (GRCm39) missense probably damaging 1.00
R8848:Plcd3 UTSW 11 102,971,446 (GRCm39) missense probably benign 0.00
R8894:Plcd3 UTSW 11 102,962,592 (GRCm39) missense probably damaging 1.00
R8983:Plcd3 UTSW 11 102,962,092 (GRCm39) missense possibly damaging 0.73
R9252:Plcd3 UTSW 11 102,968,380 (GRCm39) nonsense probably null
R9253:Plcd3 UTSW 11 102,970,460 (GRCm39) missense probably benign 0.05
X0023:Plcd3 UTSW 11 102,971,034 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGGATCCTGGCCTAGAG -3'
(R):5'- TTCCTGAGACCAAGCTCTGACC -3'

Sequencing Primer
(F):5'- GTGCATCCCAGTCAGATGG -3'
(R):5'- ATCCTGGTGCCAGTGTGC -3'
Posted On 2019-10-24