Incidental Mutation 'R7606:Usf3'
ID588328
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R7606 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44218943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1262 (T1262M)
Ref Sequence ENSEMBL: ENSMUSP00000112620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably damaging
Transcript: ENSMUST00000119746
AA Change: T1262M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: T1262M

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169582
AA Change: T1262M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: T1262M

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,036,035 probably null Het
Adat1 T C 8: 111,982,604 K196E possibly damaging Het
Aire T C 10: 78,037,933 D314G probably damaging Het
Atp11a C T 8: 12,844,427 T674I probably damaging Het
Atp8b1 T C 18: 64,555,115 D644G probably damaging Het
Bag4 A G 8: 25,769,305 S289P probably damaging Het
Bcat1 G T 6: 145,048,632 H46Q probably benign Het
Btg4 A G 9: 51,118,007 N164S probably damaging Het
Ccz1 G A 5: 144,014,808 A2V probably benign Het
Cd209g T C 8: 4,136,839 L128P probably damaging Het
Col4a2 T A 8: 11,443,571 M1380K probably benign Het
Cpox T C 16: 58,674,449 V283A probably benign Het
Dnah10 A T 5: 124,817,712 D3504V probably benign Het
Eml1 A T 12: 108,537,366 I741F probably benign Het
Fam171a2 A G 11: 102,444,176 V45A possibly damaging Het
Fem1a A G 17: 56,256,946 D13G probably damaging Het
Fkbp14 A G 6: 54,593,018 I9T probably benign Het
Golt1b G A 6: 142,392,342 G13D probably damaging Het
Heatr5b T C 17: 78,763,026 N1653D probably benign Het
Hrg A G 16: 22,951,123 M1V probably null Het
Itgb2 T A 10: 77,556,161 I356N probably damaging Het
Kcnb2 A G 1: 15,312,840 E130G probably damaging Het
Kpna2 A T 11: 106,992,058 F124Y probably damaging Het
Lyst T C 13: 13,637,475 I824T probably damaging Het
Meis2 T C 2: 116,063,320 H38R possibly damaging Het
Mknk1 T G 4: 115,877,994 I353S probably damaging Het
Mrc1 T A 2: 14,238,144 I27N probably damaging Het
Mup4 T C 4: 59,958,568 T111A probably damaging Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Neb T G 2: 52,226,444 E994A Het
Nlrc5 T C 8: 94,477,117 M615T possibly damaging Het
Nup88 T C 11: 70,961,615 E218G possibly damaging Het
Olfr1219 A G 2: 89,075,297 probably benign Het
Olfr1513 A T 14: 52,349,963 F28I probably benign Het
Parp11 A G 6: 127,470,760 D19G probably benign Het
Parp2 A T 14: 50,820,030 T429S probably damaging Het
Pcdhb6 G A 18: 37,335,606 E527K probably damaging Het
Pde8a A G 7: 81,332,967 Y778C probably damaging Het
Pea15a T C 1: 172,200,583 probably null Het
Plcd3 A G 11: 103,076,857 Y420H probably damaging Het
Ppp1ca C A 19: 4,193,089 S85R possibly damaging Het
Pth A C 7: 113,386,243 I13S probably benign Het
Rbm27 A G 18: 42,327,513 T842A probably damaging Het
Rcbtb2 T A 14: 73,182,366 probably null Het
Rubcnl C T 14: 75,038,874 L323F probably benign Het
Ryr3 A T 2: 112,645,245 Y4539* probably null Het
Scamp3 T A 3: 89,181,218 F244I probably damaging Het
Sema4d T C 13: 51,723,622 D58G probably benign Het
Skor1 G T 9: 63,145,382 A435E probably damaging Het
Slc35a4 A G 18: 36,682,585 Y156C probably benign Het
Spryd7 T C 14: 61,540,158 T158A possibly damaging Het
Srgap3 A C 6: 112,739,376 I621S probably benign Het
Tbc1d31 A G 15: 57,951,670 E581G probably damaging Het
Tcf4 C T 18: 69,642,983 T318I probably damaging Het
Vcam1 T C 3: 116,121,055 D316G possibly damaging Het
Vmn2r72 T A 7: 85,751,154 E229V possibly damaging Het
Zfhx2 T C 14: 55,066,663 E1288G probably benign Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 splice site probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
I1329:Usf3 UTSW 16 44220530 missense probably damaging 1.00
R0208:Usf3 UTSW 16 44216906 missense probably damaging 0.98
R0900:Usf3 UTSW 16 44215958 missense probably benign
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4024:Usf3 UTSW 16 44216165 missense possibly damaging 0.76
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5391:Usf3 UTSW 16 44217463 missense probably benign 0.01
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
R7379:Usf3 UTSW 16 44220576 missense probably benign 0.33
R7389:Usf3 UTSW 16 44217941 missense probably benign 0.09
R7452:Usf3 UTSW 16 44220034 missense probably benign 0.00
R7750:Usf3 UTSW 16 44220521 missense probably benign 0.15
R7765:Usf3 UTSW 16 44219063 missense probably benign 0.28
R7830:Usf3 UTSW 16 44219779 nonsense probably null
R7895:Usf3 UTSW 16 44216202 missense possibly damaging 0.67
R7941:Usf3 UTSW 16 44215561 missense probably damaging 1.00
R8280:Usf3 UTSW 16 44218501 missense probably benign 0.00
R8285:Usf3 UTSW 16 44220844 missense probably damaging 1.00
R8421:Usf3 UTSW 16 44217209 missense possibly damaging 0.67
R8692:Usf3 UTSW 16 44219740 missense probably benign 0.00
R8798:Usf3 UTSW 16 44220173 missense probably damaging 0.99
R8824:Usf3 UTSW 16 44215613 missense probably benign 0.12
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Z1176:Usf3 UTSW 16 44220431 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGACAGTCGATAGGCCTCTTG -3'
(R):5'- CAGTGCTTCTGACGTTTGGC -3'

Sequencing Primer
(F):5'- CTTGAAAAACCAAGCTGTTCTCTGGG -3'
(R):5'- AAAGATCATCTTGCACAGTGC -3'
Posted On2019-10-24